Mutagenetix > Incidental Mutations

Incidental Mutation 'R0230:Ephb3'

34083

Institutional Source

Beutler Lab

Gene Symbol

Ephb3

Ensembl Gene

ENSMUSG00000005958

Gene Name

Eph receptor B3

Synonyms

Tyro6, HEK2, MDK5, Sek4, Etk2, Cek10

MMRRC Submission

038473-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.901) question?

Stock #

R0230 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21204755-21223305 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21220775 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 426 (I426F)

Ref Sequence

ENSEMBL: ENSMUSP00000124375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006112
AA Change: I680F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: I680F

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
EPH_lbd	31	204	6.47e-126	SMART
Pfam:GCC2_GCC3	269	312	5.8e-9	PFAM
FN3	332	430	8.43e-9	SMART
FN3	448	527	2.72e-12	SMART
Pfam:EphA2_TM	555	625	1e-24	PFAM
TyrKc	628	887	1.35e-134	SMART
SAM	917	984	3.88e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160053

Predicted Effect

probably damaging
Transcript: ENSMUST00000161063
AA Change: I426F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6145

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.7%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,156,825	H2012Q	probably damaging	Het
Amy1	T	C	3: 113,558,430	D371G	probably benign	Het
Asrgl1	T	A	19: 9,118,519		probably benign	Het
Asxl3	T	A	18: 22,452,326		probably benign	Het
B3galnt1	T	C	3: 69,575,340	N196S	possibly damaging	Het
Bbof1	A	G	12: 84,425,204	H74R	probably damaging	Het
Bpifb9b	C	T	2: 154,317,075	T504M	probably damaging	Het
Cdk12	T	G	11: 98,203,991	S208R	probably damaging	Het
Cdk5r1	T	C	11: 80,477,750	L81P	probably damaging	Het
Chrd	T	C	16: 20,733,275	L43P	probably benign	Het
Col6a4	A	C	9: 106,072,366	M690R	probably benign	Het
Cyp39a1	A	T	17: 43,732,012	R418W	probably damaging	Het
Dars2	C	T	1: 161,062,787	V162M	probably benign	Het
Dixdc1	C	T	9: 50,695,507	V270M	possibly damaging	Het
Dnah11	C	A	12: 117,983,056	E1194*	probably null	Het
Dnah7b	T	C	1: 46,219,348	S1900P	probably damaging	Het
Dnah9	C	T	11: 65,855,315	E3991K	probably damaging	Het
Dsp	A	T	13: 38,197,705	I2210F	probably benign	Het
Ebf1	A	G	11: 44,996,122	S556G	probably damaging	Het
Enam	G	A	5: 88,489,655		probably benign	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Epc1	T	C	18: 6,440,168	D579G	probably damaging	Het
Fam135b	T	G	15: 71,446,037	I1359L	probably benign	Het
Gm16519	T	C	17: 70,929,133	S26P	probably benign	Het
Gm17622	T	A	13: 96,491,086		probably null	Het
Gpat2	G	A	2: 127,435,845	V764I	possibly damaging	Het
Gpx4	G	A	10: 80,055,004	A81T	probably benign	Het
Gss	C	A	2: 155,578,406	R83L	probably damaging	Het
Hcls1	C	A	16: 36,937,854	Q36K	probably damaging	Het
Hepacam2	A	G	6: 3,463,336	V438A	probably benign	Het
Hnf4a	T	C	2: 163,559,085	F184S	probably damaging	Het
Katnal1	T	A	5: 148,918,650	D90V	possibly damaging	Het
Kcnt2	A	G	1: 140,246,345	D30G	probably benign	Het
Kyat1	T	C	2: 30,194,075	E11G	probably benign	Het
Lefty1	T	A	1: 180,937,014	V168E	probably damaging	Het
Map2k6	C	T	11: 110,496,455	P218S	probably damaging	Het
Mlkl	C	G	8: 111,315,062	K415N	probably benign	Het
Myh7	A	T	14: 54,973,933	M1593K	probably benign	Het
Myo19	T	A	11: 84,893,333	C186S	possibly damaging	Het
Ngp	T	C	9: 110,420,001	L47P	probably damaging	Het
Nkiras1	A	G	14: 18,280,185	N192S	probably benign	Het
Olfr1044	T	C	2: 86,171,542	I92V	probably benign	Het
Olfr134	A	G	17: 38,175,950	I289V	probably damaging	Het
Olfr346	G	A	2: 36,688,616	V205M	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pdcd6ip	A	G	9: 113,685,293		probably benign	Het
Pde4b	T	C	4: 102,597,510	Y186H	probably benign	Het
Pex7	A	G	10: 19,904,585	V101A	possibly damaging	Het
Phldb3	G	A	7: 24,612,579	R106Q	probably benign	Het
Plxnc1	A	G	10: 94,799,347	V1339A	probably benign	Het
Proser1	A	G	3: 53,478,962	N755S	probably damaging	Het
Ptpn13	A	G	5: 103,527,131	D658G	probably damaging	Het
Rassf8	A	C	6: 145,819,974		probably benign	Het
Rfc4	G	A	16: 23,114,099	Q363*	probably null	Het
Rxfp1	T	C	3: 79,644,975	N673S	probably damaging	Het
Scn7a	T	C	2: 66,726,284	E319G	probably damaging	Het
Scnn1g	A	G	7: 121,746,761		probably benign	Het
Scube2	C	T	7: 109,824,764		probably null	Het
Slc4a4	A	C	5: 89,156,336	H502P	possibly damaging	Het
Slc6a13	A	G	6: 121,324,303	N184D	probably benign	Het
Slco1a5	T	A	6: 142,236,328		probably benign	Het
Slf1	T	A	13: 77,112,748		probably benign	Het
Smarca4	G	A	9: 21,700,872	V1518I	probably damaging	Het
Smyd3	A	G	1: 179,423,428		probably benign	Het
Sox5	A	G	6: 144,209,338	F11L	probably benign	Het
Spag17	T	C	3: 100,106,827	S2139P	probably benign	Het
Spice1	A	T	16: 44,365,576		probably benign	Het
Sptan1	T	A	2: 30,010,692		probably benign	Het
Srebf2	T	A	15: 82,182,085	N571K	probably damaging	Het
Tbl3	A	G	17: 24,701,333	L670P	probably damaging	Het
Tmem45a2	A	G	16: 57,046,996	V114A	possibly damaging	Het
Tmigd3	A	G	3: 105,918,737	N132D	possibly damaging	Het
Ttn	T	C	2: 76,737,434	D19378G	probably damaging	Het
Ugcg	C	A	4: 59,189,739	Y32*	probably null	Het
Ush2a	C	T	1: 188,850,104	P3788L	probably damaging	Het
Usp22	T	A	11: 61,159,197		probably benign	Het
Xaf1	T	C	11: 72,306,555		probably benign	Het
Zbtb41	C	T	1: 139,446,935	T711I	probably damaging	Het
Zfp457	T	C	13: 67,294,116	T132A	possibly damaging	Het
Zfp64	T	G	2: 168,912,230		probably benign	Het

Other mutations in Ephb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Ephb3	APN	16	21220415	splice site	probably null
IGL00966:Ephb3	APN	16	21217294	missense	probably benign	0.00
IGL02166:Ephb3	APN	16	21220749	missense	probably damaging	1.00
IGL02245:Ephb3	APN	16	21221424	missense	probably benign	0.04
IGL02321:Ephb3	APN	16	21214389	missense	probably damaging	1.00
IGL02337:Ephb3	APN	16	21221503	splice site	probably null
IGL02507:Ephb3	APN	16	21220639	splice site	probably benign
IGL02755:Ephb3	APN	16	21221698	missense	probably damaging	1.00
IGL02806:Ephb3	APN	16	21222281	missense	probably benign	0.02
PIT4362001:Ephb3	UTSW	16	21220857	missense	probably damaging	1.00
R0026:Ephb3	UTSW	16	21214917	missense	probably damaging	1.00
R0194:Ephb3	UTSW	16	21218109	missense	probably benign	0.01
R0196:Ephb3	UTSW	16	21218054	missense	probably damaging	1.00
R0828:Ephb3	UTSW	16	21219034	unclassified	probably benign
R1126:Ephb3	UTSW	16	21222476	missense	possibly damaging	0.87
R1460:Ephb3	UTSW	16	21218922	missense	probably benign
R1592:Ephb3	UTSW	16	21221700	missense	probably damaging	1.00
R1632:Ephb3	UTSW	16	21212937	missense	probably benign	0.00
R1694:Ephb3	UTSW	16	21221745	missense	probably damaging	1.00
R1719:Ephb3	UTSW	16	21220650	missense	probably damaging	1.00
R1777:Ephb3	UTSW	16	21217235	missense	probably damaging	0.99
R1928:Ephb3	UTSW	16	21222295	missense	possibly damaging	0.86
R1956:Ephb3	UTSW	16	21221382	missense	probably damaging	1.00
R2378:Ephb3	UTSW	16	21218243	missense	probably benign
R3408:Ephb3	UTSW	16	21219504	missense	probably damaging	0.99
R4027:Ephb3	UTSW	16	21221697	missense	probably damaging	1.00
R4429:Ephb3	UTSW	16	21214463	missense	probably damaging	1.00
R4655:Ephb3	UTSW	16	21222208	missense	probably damaging	0.98
R4826:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4828:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4960:Ephb3	UTSW	16	21220495	missense	probably benign	0.09
R5057:Ephb3	UTSW	16	21220447	missense	probably damaging	1.00
R5090:Ephb3	UTSW	16	21214487	missense	probably damaging	1.00
R5396:Ephb3	UTSW	16	21219105	missense	possibly damaging	0.91
R5540:Ephb3	UTSW	16	21220860	missense	probably damaging	1.00
R5628:Ephb3	UTSW	16	21218119	missense	probably damaging	1.00
R5666:Ephb3	UTSW	16	21222491	missense	probably benign	0.08
R5838:Ephb3	UTSW	16	21221687	missense	probably damaging	1.00
R5866:Ephb3	UTSW	16	21211379	intron	probably benign
R6017:Ephb3	UTSW	16	21222031	missense	probably damaging	1.00
R6020:Ephb3	UTSW	16	21222013	missense	probably damaging	0.99
R6510:Ephb3	UTSW	16	21218111	missense	probably damaging	0.98
R6539:Ephb3	UTSW	16	21221468	missense	probably benign
R6591:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R6691:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R7101:Ephb3	UTSW	16	21218518	missense	possibly damaging	0.86
R7111:Ephb3	UTSW	16	21218827	nonsense	probably null
R7236:Ephb3	UTSW	16	21214481	missense	probably damaging	1.00
R7307:Ephb3	UTSW	16	21222226	missense	probably benign	0.04
R7410:Ephb3	UTSW	16	21221408	missense	possibly damaging	0.75
R7413:Ephb3	UTSW	16	21214707	missense	probably damaging	1.00
R7452:Ephb3	UTSW	16	21217357	splice site	probably null
R7944:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R7945:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
Z1176:Ephb3	UTSW	16	21218036	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- GTAAGCTGAGAGCAAGTGGTCCTG -3'
(R):5'- AAGCCCTCTGAGATCATGCTTTGTC -3'

Sequencing Primer
(F):5'- AAGTGGTCCTGCAAGGC -3'
(R):5'- ttagaccacacagacagtaagag -3'

Posted On

2013-05-09