Incidental Mutation 'R0230:Ephb3'
ID34083
Institutional Source Beutler Lab
Gene Symbol Ephb3
Ensembl Gene ENSMUSG00000005958
Gene NameEph receptor B3
SynonymsTyro6, HEK2, MDK5, Sek4, Etk2, Cek10
MMRRC Submission 038473-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R0230 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location21204755-21223305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21220775 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 426 (I426F)
Ref Sequence ENSEMBL: ENSMUSP00000124375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]
Predicted Effect probably damaging
Transcript: ENSMUST00000006112
AA Change: I680F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: I680F

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
EPH_lbd 31 204 6.47e-126 SMART
Pfam:GCC2_GCC3 269 312 5.8e-9 PFAM
FN3 332 430 8.43e-9 SMART
FN3 448 527 2.72e-12 SMART
Pfam:EphA2_TM 555 625 1e-24 PFAM
TyrKc 628 887 1.35e-134 SMART
SAM 917 984 3.88e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160053
Predicted Effect probably damaging
Transcript: ENSMUST00000161063
AA Change: I426F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6145 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,825 H2012Q probably damaging Het
Amy1 T C 3: 113,558,430 D371G probably benign Het
Asrgl1 T A 19: 9,118,519 probably benign Het
Asxl3 T A 18: 22,452,326 probably benign Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Bbof1 A G 12: 84,425,204 H74R probably damaging Het
Bpifb9b C T 2: 154,317,075 T504M probably damaging Het
Cdk12 T G 11: 98,203,991 S208R probably damaging Het
Cdk5r1 T C 11: 80,477,750 L81P probably damaging Het
Chrd T C 16: 20,733,275 L43P probably benign Het
Col6a4 A C 9: 106,072,366 M690R probably benign Het
Cyp39a1 A T 17: 43,732,012 R418W probably damaging Het
Dars2 C T 1: 161,062,787 V162M probably benign Het
Dixdc1 C T 9: 50,695,507 V270M possibly damaging Het
Dnah11 C A 12: 117,983,056 E1194* probably null Het
Dnah7b T C 1: 46,219,348 S1900P probably damaging Het
Dnah9 C T 11: 65,855,315 E3991K probably damaging Het
Dsp A T 13: 38,197,705 I2210F probably benign Het
Ebf1 A G 11: 44,996,122 S556G probably damaging Het
Enam G A 5: 88,489,655 probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Epc1 T C 18: 6,440,168 D579G probably damaging Het
Fam135b T G 15: 71,446,037 I1359L probably benign Het
Gm16519 T C 17: 70,929,133 S26P probably benign Het
Gm17622 T A 13: 96,491,086 probably null Het
Gpat2 G A 2: 127,435,845 V764I possibly damaging Het
Gpx4 G A 10: 80,055,004 A81T probably benign Het
Gss C A 2: 155,578,406 R83L probably damaging Het
Hcls1 C A 16: 36,937,854 Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 V438A probably benign Het
Hnf4a T C 2: 163,559,085 F184S probably damaging Het
Katnal1 T A 5: 148,918,650 D90V possibly damaging Het
Kcnt2 A G 1: 140,246,345 D30G probably benign Het
Kyat1 T C 2: 30,194,075 E11G probably benign Het
Lefty1 T A 1: 180,937,014 V168E probably damaging Het
Map2k6 C T 11: 110,496,455 P218S probably damaging Het
Mlkl C G 8: 111,315,062 K415N probably benign Het
Myh7 A T 14: 54,973,933 M1593K probably benign Het
Myo19 T A 11: 84,893,333 C186S possibly damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 N192S probably benign Het
Olfr1044 T C 2: 86,171,542 I92V probably benign Het
Olfr134 A G 17: 38,175,950 I289V probably damaging Het
Olfr346 G A 2: 36,688,616 V205M probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pdcd6ip A G 9: 113,685,293 probably benign Het
Pde4b T C 4: 102,597,510 Y186H probably benign Het
Pex7 A G 10: 19,904,585 V101A possibly damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Plxnc1 A G 10: 94,799,347 V1339A probably benign Het
Proser1 A G 3: 53,478,962 N755S probably damaging Het
Ptpn13 A G 5: 103,527,131 D658G probably damaging Het
Rassf8 A C 6: 145,819,974 probably benign Het
Rfc4 G A 16: 23,114,099 Q363* probably null Het
Rxfp1 T C 3: 79,644,975 N673S probably damaging Het
Scn7a T C 2: 66,726,284 E319G probably damaging Het
Scnn1g A G 7: 121,746,761 probably benign Het
Scube2 C T 7: 109,824,764 probably null Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc6a13 A G 6: 121,324,303 N184D probably benign Het
Slco1a5 T A 6: 142,236,328 probably benign Het
Slf1 T A 13: 77,112,748 probably benign Het
Smarca4 G A 9: 21,700,872 V1518I probably damaging Het
Smyd3 A G 1: 179,423,428 probably benign Het
Sox5 A G 6: 144,209,338 F11L probably benign Het
Spag17 T C 3: 100,106,827 S2139P probably benign Het
Spice1 A T 16: 44,365,576 probably benign Het
Sptan1 T A 2: 30,010,692 probably benign Het
Srebf2 T A 15: 82,182,085 N571K probably damaging Het
Tbl3 A G 17: 24,701,333 L670P probably damaging Het
Tmem45a2 A G 16: 57,046,996 V114A possibly damaging Het
Tmigd3 A G 3: 105,918,737 N132D possibly damaging Het
Ttn T C 2: 76,737,434 D19378G probably damaging Het
Ugcg C A 4: 59,189,739 Y32* probably null Het
Ush2a C T 1: 188,850,104 P3788L probably damaging Het
Usp22 T A 11: 61,159,197 probably benign Het
Xaf1 T C 11: 72,306,555 probably benign Het
Zbtb41 C T 1: 139,446,935 T711I probably damaging Het
Zfp457 T C 13: 67,294,116 T132A possibly damaging Het
Zfp64 T G 2: 168,912,230 probably benign Het
Other mutations in Ephb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ephb3 APN 16 21220415 splice site probably null
IGL00966:Ephb3 APN 16 21217294 missense probably benign 0.00
IGL02166:Ephb3 APN 16 21220749 missense probably damaging 1.00
IGL02245:Ephb3 APN 16 21221424 missense probably benign 0.04
IGL02321:Ephb3 APN 16 21214389 missense probably damaging 1.00
IGL02337:Ephb3 APN 16 21221503 splice site probably null
IGL02507:Ephb3 APN 16 21220639 splice site probably benign
IGL02755:Ephb3 APN 16 21221698 missense probably damaging 1.00
IGL02806:Ephb3 APN 16 21222281 missense probably benign 0.02
PIT4362001:Ephb3 UTSW 16 21220857 missense probably damaging 1.00
R0026:Ephb3 UTSW 16 21214917 missense probably damaging 1.00
R0194:Ephb3 UTSW 16 21218109 missense probably benign 0.01
R0196:Ephb3 UTSW 16 21218054 missense probably damaging 1.00
R0828:Ephb3 UTSW 16 21219034 unclassified probably benign
R1126:Ephb3 UTSW 16 21222476 missense possibly damaging 0.87
R1460:Ephb3 UTSW 16 21218922 missense probably benign
R1592:Ephb3 UTSW 16 21221700 missense probably damaging 1.00
R1632:Ephb3 UTSW 16 21212937 missense probably benign 0.00
R1694:Ephb3 UTSW 16 21221745 missense probably damaging 1.00
R1719:Ephb3 UTSW 16 21220650 missense probably damaging 1.00
R1777:Ephb3 UTSW 16 21217235 missense probably damaging 0.99
R1928:Ephb3 UTSW 16 21222295 missense possibly damaging 0.86
R1956:Ephb3 UTSW 16 21221382 missense probably damaging 1.00
R2378:Ephb3 UTSW 16 21218243 missense probably benign
R3408:Ephb3 UTSW 16 21219504 missense probably damaging 0.99
R4027:Ephb3 UTSW 16 21221697 missense probably damaging 1.00
R4429:Ephb3 UTSW 16 21214463 missense probably damaging 1.00
R4655:Ephb3 UTSW 16 21222208 missense probably damaging 0.98
R4826:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4828:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4960:Ephb3 UTSW 16 21220495 missense probably benign 0.09
R5057:Ephb3 UTSW 16 21220447 missense probably damaging 1.00
R5090:Ephb3 UTSW 16 21214487 missense probably damaging 1.00
R5396:Ephb3 UTSW 16 21219105 missense possibly damaging 0.91
R5540:Ephb3 UTSW 16 21220860 missense probably damaging 1.00
R5628:Ephb3 UTSW 16 21218119 missense probably damaging 1.00
R5666:Ephb3 UTSW 16 21222491 missense probably benign 0.08
R5838:Ephb3 UTSW 16 21221687 missense probably damaging 1.00
R5866:Ephb3 UTSW 16 21211379 intron probably benign
R6017:Ephb3 UTSW 16 21222031 missense probably damaging 1.00
R6020:Ephb3 UTSW 16 21222013 missense probably damaging 0.99
R6510:Ephb3 UTSW 16 21218111 missense probably damaging 0.98
R6539:Ephb3 UTSW 16 21221468 missense probably benign
R6591:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R6691:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R7101:Ephb3 UTSW 16 21218518 missense possibly damaging 0.86
R7111:Ephb3 UTSW 16 21218827 nonsense probably null
R7236:Ephb3 UTSW 16 21214481 missense probably damaging 1.00
R7307:Ephb3 UTSW 16 21222226 missense probably benign 0.04
R7410:Ephb3 UTSW 16 21221408 missense possibly damaging 0.75
R7413:Ephb3 UTSW 16 21214707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGCTGAGAGCAAGTGGTCCTG -3'
(R):5'- AAGCCCTCTGAGATCATGCTTTGTC -3'

Sequencing Primer
(F):5'- AAGTGGTCCTGCAAGGC -3'
(R):5'- ttagaccacacagacagtaagag -3'
Posted On2013-05-09