Incidental Mutation 'R0230:Cyp39a1'
ID34090
Institutional Source Beutler Lab
Gene Symbol Cyp39a1
Ensembl Gene ENSMUSG00000023963
Gene Namecytochrome P450, family 39, subfamily a, polypeptide 1
Synonymsoxysterol 7-alpha-hydroxylase
MMRRC Submission 038473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0230 (G1)
Quality Score104
Status Validated
Chromosome17
Chromosomal Location43667425-43751431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43732012 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 418 (R418W)
Ref Sequence ENSEMBL: ENSMUSP00000130073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170988]
Predicted Effect probably damaging
Transcript: ENSMUST00000170988
AA Change: R418W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963
AA Change: R418W

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Meta Mutation Damage Score 0.6301 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,825 H2012Q probably damaging Het
Amy1 T C 3: 113,558,430 D371G probably benign Het
Asrgl1 T A 19: 9,118,519 probably benign Het
Asxl3 T A 18: 22,452,326 probably benign Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Bbof1 A G 12: 84,425,204 H74R probably damaging Het
Bpifb9b C T 2: 154,317,075 T504M probably damaging Het
Cdk12 T G 11: 98,203,991 S208R probably damaging Het
Cdk5r1 T C 11: 80,477,750 L81P probably damaging Het
Chrd T C 16: 20,733,275 L43P probably benign Het
Col6a4 A C 9: 106,072,366 M690R probably benign Het
Dars2 C T 1: 161,062,787 V162M probably benign Het
Dixdc1 C T 9: 50,695,507 V270M possibly damaging Het
Dnah11 C A 12: 117,983,056 E1194* probably null Het
Dnah7b T C 1: 46,219,348 S1900P probably damaging Het
Dnah9 C T 11: 65,855,315 E3991K probably damaging Het
Dsp A T 13: 38,197,705 I2210F probably benign Het
Ebf1 A G 11: 44,996,122 S556G probably damaging Het
Enam G A 5: 88,489,655 probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Epc1 T C 18: 6,440,168 D579G probably damaging Het
Ephb3 A T 16: 21,220,775 I426F probably damaging Het
Fam135b T G 15: 71,446,037 I1359L probably benign Het
Gm16519 T C 17: 70,929,133 S26P probably benign Het
Gm17622 T A 13: 96,491,086 probably null Het
Gpat2 G A 2: 127,435,845 V764I possibly damaging Het
Gpx4 G A 10: 80,055,004 A81T probably benign Het
Gss C A 2: 155,578,406 R83L probably damaging Het
Hcls1 C A 16: 36,937,854 Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 V438A probably benign Het
Hnf4a T C 2: 163,559,085 F184S probably damaging Het
Katnal1 T A 5: 148,918,650 D90V possibly damaging Het
Kcnt2 A G 1: 140,246,345 D30G probably benign Het
Kyat1 T C 2: 30,194,075 E11G probably benign Het
Lefty1 T A 1: 180,937,014 V168E probably damaging Het
Map2k6 C T 11: 110,496,455 P218S probably damaging Het
Mlkl C G 8: 111,315,062 K415N probably benign Het
Myh7 A T 14: 54,973,933 M1593K probably benign Het
Myo19 T A 11: 84,893,333 C186S possibly damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 N192S probably benign Het
Olfr1044 T C 2: 86,171,542 I92V probably benign Het
Olfr134 A G 17: 38,175,950 I289V probably damaging Het
Olfr346 G A 2: 36,688,616 V205M probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pdcd6ip A G 9: 113,685,293 probably benign Het
Pde4b T C 4: 102,597,510 Y186H probably benign Het
Pex7 A G 10: 19,904,585 V101A possibly damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Plxnc1 A G 10: 94,799,347 V1339A probably benign Het
Proser1 A G 3: 53,478,962 N755S probably damaging Het
Ptpn13 A G 5: 103,527,131 D658G probably damaging Het
Rassf8 A C 6: 145,819,974 probably benign Het
Rfc4 G A 16: 23,114,099 Q363* probably null Het
Rxfp1 T C 3: 79,644,975 N673S probably damaging Het
Scn7a T C 2: 66,726,284 E319G probably damaging Het
Scnn1g A G 7: 121,746,761 probably benign Het
Scube2 C T 7: 109,824,764 probably null Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc6a13 A G 6: 121,324,303 N184D probably benign Het
Slco1a5 T A 6: 142,236,328 probably benign Het
Slf1 T A 13: 77,112,748 probably benign Het
Smarca4 G A 9: 21,700,872 V1518I probably damaging Het
Smyd3 A G 1: 179,423,428 probably benign Het
Sox5 A G 6: 144,209,338 F11L probably benign Het
Spag17 T C 3: 100,106,827 S2139P probably benign Het
Spice1 A T 16: 44,365,576 probably benign Het
Sptan1 T A 2: 30,010,692 probably benign Het
Srebf2 T A 15: 82,182,085 N571K probably damaging Het
Tbl3 A G 17: 24,701,333 L670P probably damaging Het
Tmem45a2 A G 16: 57,046,996 V114A possibly damaging Het
Tmigd3 A G 3: 105,918,737 N132D possibly damaging Het
Ttn T C 2: 76,737,434 D19378G probably damaging Het
Ugcg C A 4: 59,189,739 Y32* probably null Het
Ush2a C T 1: 188,850,104 P3788L probably damaging Het
Usp22 T A 11: 61,159,197 probably benign Het
Xaf1 T C 11: 72,306,555 probably benign Het
Zbtb41 C T 1: 139,446,935 T711I probably damaging Het
Zfp457 T C 13: 67,294,116 T132A possibly damaging Het
Zfp64 T G 2: 168,912,230 probably benign Het
Other mutations in Cyp39a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Cyp39a1 APN 17 43701543 missense probably benign 0.01
IGL01070:Cyp39a1 APN 17 43683022 missense probably benign 0.00
IGL01606:Cyp39a1 APN 17 43746618 splice site probably benign
IGL01769:Cyp39a1 APN 17 43749915 missense possibly damaging 0.53
IGL01916:Cyp39a1 APN 17 43731050 missense probably damaging 1.00
IGL02374:Cyp39a1 APN 17 43749981 utr 3 prime probably benign
IGL02402:Cyp39a1 APN 17 43691722 missense probably benign 0.07
IGL03097:Cyp39a1 UTSW 17 43683050 nonsense probably null
R1244:Cyp39a1 UTSW 17 43749945 missense probably benign 0.13
R1572:Cyp39a1 UTSW 17 43680129 missense probably damaging 1.00
R1656:Cyp39a1 UTSW 17 43667619 missense possibly damaging 0.74
R4036:Cyp39a1 UTSW 17 43676940 missense probably damaging 0.97
R4308:Cyp39a1 UTSW 17 43730964 splice site probably null
R5081:Cyp39a1 UTSW 17 43746597 missense probably damaging 1.00
R5197:Cyp39a1 UTSW 17 43746538 missense possibly damaging 0.67
R5405:Cyp39a1 UTSW 17 43676940 missense probably damaging 1.00
R5566:Cyp39a1 UTSW 17 43685208 missense possibly damaging 0.92
R5578:Cyp39a1 UTSW 17 43680140 missense possibly damaging 0.91
R6045:Cyp39a1 UTSW 17 43731991 missense probably damaging 1.00
R6495:Cyp39a1 UTSW 17 43691694 missense probably benign 0.41
R7191:Cyp39a1 UTSW 17 43731019 nonsense probably null
R7431:Cyp39a1 UTSW 17 43683015 missense probably benign
R7522:Cyp39a1 UTSW 17 43667479 start gained probably benign
R7620:Cyp39a1 UTSW 17 43725653 splice site probably null
R8022:Cyp39a1 UTSW 17 43746577 missense probably damaging 1.00
R8143:Cyp39a1 UTSW 17 43725626 missense probably benign 0.39
Z1176:Cyp39a1 UTSW 17 43725577 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43731048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGGATTAGCTGTCCAGCATC -3'
(R):5'- TTCAGACTGCCCATGTGTGAACC -3'

Sequencing Primer
(F):5'- GTCCAGCATCATTTTTAGCTCAGAG -3'
(R):5'- TCCTCTGGCACTAGCAAGTATAG -3'
Posted On2013-05-09