Mutagenetix > Incidental Mutation

Incidental Mutation 'R0336:Fga'

34099

Institutional Source

Beutler Lab

Gene Symbol

Fga

Ensembl Gene

ENSMUSG00000028001

Gene Name

fibrinogen alpha chain

Synonyms

ENSMUSG00000059807, Fib

MMRRC Submission

038545-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.294) question?

Stock #

R0336 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83026076-83033627 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83030857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 180 (S180P)

Ref Sequence

ENSEMBL: ENSMUSP00000133117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]

AlphaFold

E9PV24

Predicted Effect

probably damaging
Transcript: ENSMUST00000029630
AA Change: S180P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: S180P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	458	1.6e-33	PFAM
low complexity region	500	522	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166581
AA Change: S180P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: S180P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	457	9.3e-34	PFAM
low complexity region	500	522	N/A	INTRINSIC
FBG	550	786	1.43e-128	SMART

Meta Mutation Damage Score

0.2087

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 98.1%
20x: 97.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,298,481	I2743V	probably benign	Het
Adamts16	A	G	13: 70,791,794		probably benign	Het
Adgrb1	A	G	15: 74,587,149	I427V	probably benign	Het
Apopt1	T	C	12: 111,733,658		probably benign	Het
Arhgef1	T	A	7: 24,921,957	F510I	possibly damaging	Het
B3glct	A	G	5: 149,746,592	D342G	probably damaging	Het
Bcl2a1c	G	T	9: 114,330,285	V44F	probably damaging	Het
Brca1	A	G	11: 101,523,993	V1105A	probably benign	Het
Cep135	A	G	5: 76,601,502	H272R	probably benign	Het
Cog1	A	C	11: 113,662,250	H365P	probably benign	Het
Col12a1	A	T	9: 79,702,345	L293Q	probably damaging	Het
Col18a1	A	G	10: 77,058,736	L1493P	probably damaging	Het
Ctsh	A	G	9: 90,075,738	Y290C	probably damaging	Het
Dach1	C	T	14: 98,168,748	G188R	probably damaging	Het
Defb39	G	T	8: 19,052,969	H37N	possibly damaging	Het
Epha3	A	G	16: 63,566,648	I875T	probably damaging	Het
Fbrsl1	A	G	5: 110,447,951	S73P	probably damaging	Het
Fndc1	C	T	17: 7,765,107	R1329Q	unknown	Het
Fyn	C	A	10: 39,526,901	T223K	possibly damaging	Het
Galnt6	A	T	15: 100,699,206	S360T	probably damaging	Het
Gm10436	T	C	12: 88,178,191	I122V	probably benign	Het
Grsf1	C	A	5: 88,663,153	V336F	probably damaging	Het
Hip1	A	T	5: 135,428,613	Y720N	probably benign	Het
Hivep3	G	A	4: 120,103,847	E1700K	probably damaging	Het
Ifna6	T	C	4: 88,827,941	S176P	probably damaging	Het
Lilr4b	T	A	10: 51,481,293	L75Q	probably benign	Het
Lrig3	C	T	10: 125,966,705	T77I	probably benign	Het
Mpped1	C	T	15: 83,836,282	P135L	probably damaging	Het
Mss51	T	A	14: 20,483,186	I406F	possibly damaging	Het
Mybpc2	T	C	7: 44,505,616	N956D	probably damaging	Het
Olfr1197	T	C	2: 88,729,154	I148M	possibly damaging	Het
Podxl2	G	A	6: 88,849,595	T243I	probably benign	Het
Polr2a	C	T	11: 69,736,893	R1396Q	possibly damaging	Het
Pygm	C	T	19: 6,388,758	R205W	probably damaging	Het
Rfx3	A	G	19: 27,806,262	M428T	probably benign	Het
Ric1	A	T	19: 29,587,793	T647S	probably damaging	Het
Rictor	G	A	15: 6,776,753		probably null	Het
Rnf38	A	T	4: 44,152,350		probably benign	Het
Slc6a21	T	A	7: 45,286,468	I41K	probably damaging	Het
St8sia4	T	A	1: 95,653,558	D153V	probably benign	Het
Stk33	T	C	7: 109,331,474	N226S	probably benign	Het
Strn3	A	G	12: 51,661,608		probably null	Het
Tlr6	G	T	5: 64,953,946	N539K	probably benign	Het
Tmem129	G	T	5: 33,655,602	P134Q	probably damaging	Het
Tmem94	A	G	11: 115,787,385	I145V	probably benign	Het
Trap1	A	C	16: 4,044,626	V596G	probably damaging	Het
Tspan2	A	G	3: 102,735,027	I11V	probably null	Het
Ttc23	A	T	7: 67,662,483	H46L	probably benign	Het
Txnip	T	A	3: 96,559,979	D292E	probably benign	Het
Vmn1r121	T	A	7: 21,098,462	I18F	possibly damaging	Het
Vmn1r61	G	A	7: 5,611,067	H83Y	probably benign	Het
Vmn1r82	T	C	7: 12,305,321	S174P	probably benign	Het
Vmn2r79	A	C	7: 87,002,079	T229P	probably benign	Het
Vps13b	T	G	15: 35,455,133	Y729*	probably null	Het
Wisp2	C	A	2: 163,832,322	A214D	probably damaging	Het
Xdh	C	T	17: 73,922,463	V332M	possibly damaging	Het
Xkr5	C	A	8: 18,940,636	R205L	possibly damaging	Het
Zc3h4	T	C	7: 16,435,178	S1071P	unknown	Het
Zc3h6	A	G	2: 129,015,412	H617R	possibly damaging	Het
Zfp597	A	G	16: 3,866,379	V171A	probably benign	Het
Zfp709	T	C	8: 71,890,605	F626S	probably damaging	Het
Zfp944	C	A	17: 22,339,028	D413Y	probably damaging	Het
Zfp979	A	C	4: 147,613,135	S372R	possibly damaging	Het

Other mutations in Fga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Fga	APN	3	83031674	missense	probably damaging	1.00
IGL00478:Fga	APN	3	83028644	missense	probably benign	0.00
IGL00587:Fga	APN	3	83030289	missense	possibly damaging	0.62
IGL01289:Fga	APN	3	83031245	missense	possibly damaging	0.85
IGL01323:Fga	APN	3	83030211	missense	probably damaging	0.99
IGL01369:Fga	APN	3	83030200	missense	probably benign	0.00
IGL01409:Fga	APN	3	83032752	missense	probably damaging	1.00
IGL01541:Fga	APN	3	83032707	missense	probably damaging	1.00
IGL01633:Fga	APN	3	83030299	missense	possibly damaging	0.89
IGL01966:Fga	APN	3	83029154	missense	probably damaging	0.97
IGL02651:Fga	APN	3	83028534	missense	probably benign	0.00
IGL02822:Fga	APN	3	83031482	missense	probably damaging	1.00
IGL03003:Fga	APN	3	83032730	missense	probably damaging	1.00
R0540:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R0607:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R1471:Fga	UTSW	3	83028618	missense	probably benign	0.16
R1517:Fga	UTSW	3	83031838	missense	probably benign	0.00
R1817:Fga	UTSW	3	83031775	missense	probably benign	0.00
R1874:Fga	UTSW	3	83032721	missense	probably damaging	1.00
R2014:Fga	UTSW	3	83032757	missense	probably damaging	0.99
R2267:Fga	UTSW	3	83032950	missense	probably damaging	1.00
R2332:Fga	UTSW	3	83031397	missense	probably damaging	1.00
R2420:Fga	UTSW	3	83033154	missense	possibly damaging	0.53
R2443:Fga	UTSW	3	83028541	missense	probably benign	0.03
R3978:Fga	UTSW	3	83030183	critical splice acceptor site	probably null
R4597:Fga	UTSW	3	83031235	nonsense	probably null
R4644:Fga	UTSW	3	83030266	missense	possibly damaging	0.81
R4760:Fga	UTSW	3	83031514	missense	probably benign
R4867:Fga	UTSW	3	83028644	missense	probably benign	0.00
R5449:Fga	UTSW	3	83030862	frame shift	probably null
R5507:Fga	UTSW	3	83033336	missense	probably damaging	1.00
R5712:Fga	UTSW	3	83033133	missense	possibly damaging	0.70
R6853:Fga	UTSW	3	83030912	missense	probably damaging	1.00
R6865:Fga	UTSW	3	83031541	missense	probably damaging	1.00
R7163:Fga	UTSW	3	83026264	missense	probably benign	0.04
R7724:Fga	UTSW	3	83029125	missense	probably damaging	0.99
R8153:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R8506:Fga	UTSW	3	83033316	missense	probably damaging	1.00
R8511:Fga	UTSW	3	83031757	nonsense	probably null
R8523:Fga	UTSW	3	83030851	missense	probably damaging	1.00
R8801:Fga	UTSW	3	83030881	missense	possibly damaging	0.89
R8906:Fga	UTSW	3	83031804	missense	probably benign	0.12
R9390:Fga	UTSW	3	83033303	missense	probably damaging	1.00
R9609:Fga	UTSW	3	83032757	missense	probably damaging	1.00
X0062:Fga	UTSW	3	83030271	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TGAGGACCAGCCTGAGTAGCTAAAG -3'
(R):5'- TGCAAAGTCCCCTCTAGAATCTCCC -3'

Sequencing Primer
(F):5'- CAGCCTGAGTAGCTAAAGACAAAG -3'
(R):5'- GCGAGTCTCCTGGTGAATCTC -3'

Posted On

2013-05-09