Incidental Mutation 'R0336:Fga'
ID34099
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission 038545-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R0336 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83030857 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 180 (S180P)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably damaging
Transcript: ENSMUST00000029630
AA Change: S180P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: S180P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166581
AA Change: S180P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: S180P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Meta Mutation Damage Score 0.2087 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,298,481 I2743V probably benign Het
Adamts16 A G 13: 70,791,794 probably benign Het
Adgrb1 A G 15: 74,587,149 I427V probably benign Het
Apopt1 T C 12: 111,733,658 probably benign Het
Arhgef1 T A 7: 24,921,957 F510I possibly damaging Het
B3glct A G 5: 149,746,592 D342G probably damaging Het
Bcl2a1c G T 9: 114,330,285 V44F probably damaging Het
Brca1 A G 11: 101,523,993 V1105A probably benign Het
Cep135 A G 5: 76,601,502 H272R probably benign Het
Cog1 A C 11: 113,662,250 H365P probably benign Het
Col12a1 A T 9: 79,702,345 L293Q probably damaging Het
Col18a1 A G 10: 77,058,736 L1493P probably damaging Het
Ctsh A G 9: 90,075,738 Y290C probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb39 G T 8: 19,052,969 H37N possibly damaging Het
Epha3 A G 16: 63,566,648 I875T probably damaging Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fndc1 C T 17: 7,765,107 R1329Q unknown Het
Fyn C A 10: 39,526,901 T223K possibly damaging Het
Galnt6 A T 15: 100,699,206 S360T probably damaging Het
Gm10436 T C 12: 88,178,191 I122V probably benign Het
Grsf1 C A 5: 88,663,153 V336F probably damaging Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hivep3 G A 4: 120,103,847 E1700K probably damaging Het
Ifna6 T C 4: 88,827,941 S176P probably damaging Het
Lilr4b T A 10: 51,481,293 L75Q probably benign Het
Lrig3 C T 10: 125,966,705 T77I probably benign Het
Mpped1 C T 15: 83,836,282 P135L probably damaging Het
Mss51 T A 14: 20,483,186 I406F possibly damaging Het
Mybpc2 T C 7: 44,505,616 N956D probably damaging Het
Olfr1197 T C 2: 88,729,154 I148M possibly damaging Het
Podxl2 G A 6: 88,849,595 T243I probably benign Het
Polr2a C T 11: 69,736,893 R1396Q possibly damaging Het
Pygm C T 19: 6,388,758 R205W probably damaging Het
Rfx3 A G 19: 27,806,262 M428T probably benign Het
Ric1 A T 19: 29,587,793 T647S probably damaging Het
Rictor G A 15: 6,776,753 probably null Het
Rnf38 A T 4: 44,152,350 probably benign Het
Slc6a21 T A 7: 45,286,468 I41K probably damaging Het
St8sia4 T A 1: 95,653,558 D153V probably benign Het
Stk33 T C 7: 109,331,474 N226S probably benign Het
Strn3 A G 12: 51,661,608 probably null Het
Tlr6 G T 5: 64,953,946 N539K probably benign Het
Tmem129 G T 5: 33,655,602 P134Q probably damaging Het
Tmem94 A G 11: 115,787,385 I145V probably benign Het
Trap1 A C 16: 4,044,626 V596G probably damaging Het
Tspan2 A G 3: 102,735,027 I11V probably null Het
Ttc23 A T 7: 67,662,483 H46L probably benign Het
Txnip T A 3: 96,559,979 D292E probably benign Het
Vmn1r121 T A 7: 21,098,462 I18F possibly damaging Het
Vmn1r61 G A 7: 5,611,067 H83Y probably benign Het
Vmn1r82 T C 7: 12,305,321 S174P probably benign Het
Vmn2r79 A C 7: 87,002,079 T229P probably benign Het
Vps13b T G 15: 35,455,133 Y729* probably null Het
Wisp2 C A 2: 163,832,322 A214D probably damaging Het
Xdh C T 17: 73,922,463 V332M possibly damaging Het
Xkr5 C A 8: 18,940,636 R205L possibly damaging Het
Zc3h4 T C 7: 16,435,178 S1071P unknown Het
Zc3h6 A G 2: 129,015,412 H617R possibly damaging Het
Zfp597 A G 16: 3,866,379 V171A probably benign Het
Zfp709 T C 8: 71,890,605 F626S probably damaging Het
Zfp944 C A 17: 22,339,028 D413Y probably damaging Het
Zfp979 A C 4: 147,613,135 S372R possibly damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGAGGACCAGCCTGAGTAGCTAAAG -3'
(R):5'- TGCAAAGTCCCCTCTAGAATCTCCC -3'

Sequencing Primer
(F):5'- CAGCCTGAGTAGCTAAAGACAAAG -3'
(R):5'- GCGAGTCTCCTGGTGAATCTC -3'
Posted On2013-05-09