Incidental Mutation 'R0336:Tmem129'
ID34105
Institutional Source Beutler Lab
Gene Symbol Tmem129
Ensembl Gene ENSMUSG00000019295
Gene Nametransmembrane protein 129
Synonyms
MMRRC Submission 038545-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0336 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33653216-33658416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33655602 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 134 (P134Q)
Ref Sequence ENSEMBL: ENSMUSP00000019439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019439] [ENSMUST00000057551] [ENSMUST00000074849] [ENSMUST00000075670] [ENSMUST00000079534] [ENSMUST00000101354] [ENSMUST00000114426] [ENSMUST00000139518] [ENSMUST00000151081] [ENSMUST00000152847] [ENSMUST00000200849] [ENSMUST00000201633]
Predicted Effect probably damaging
Transcript: ENSMUST00000019439
AA Change: P134Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019439
Gene: ENSMUSG00000019295
AA Change: P134Q

DomainStartEndE-ValueType
Pfam:Tmpp129 17 361 6.8e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057551
SMART Domains Protein: ENSMUSP00000062930
Gene: ENSMUSG00000004642

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
low complexity region 105 123 N/A INTRINSIC
Pfam:SLBP_RNA_bind 130 199 2e-32 PFAM
low complexity region 217 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074849
SMART Domains Protein: ENSMUSP00000074394
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 127 143 N/A INTRINSIC
internal_repeat_1 144 212 2.67e-29 PROSPERO
internal_repeat_1 240 308 2.67e-29 PROSPERO
Pfam:TACC 435 631 2.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075670
SMART Domains Protein: ENSMUSP00000075093
Gene: ENSMUSG00000004642

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
low complexity region 105 123 N/A INTRINSIC
Pfam:SLBP_RNA_bind 128 201 6.1e-39 PFAM
low complexity region 217 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079534
SMART Domains Protein: ENSMUSP00000078491
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 127 143 N/A INTRINSIC
internal_repeat_1 144 212 2.48e-29 PROSPERO
internal_repeat_1 240 308 2.48e-29 PROSPERO
Pfam:TACC 427 629 2.1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101354
SMART Domains Protein: ENSMUSP00000098906
Gene: ENSMUSG00000004642

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:SLBP_RNA_bind 108 180 8.1e-39 PFAM
low complexity region 197 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114426
SMART Domains Protein: ENSMUSP00000110069
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 127 143 N/A INTRINSIC
internal_repeat_1 144 212 2.48e-29 PROSPERO
internal_repeat_1 240 308 2.48e-29 PROSPERO
Pfam:TACC 427 629 2.1e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125527
SMART Domains Protein: ENSMUSP00000115390
Gene: ENSMUSG00000019295

DomainStartEndE-ValueType
Pfam:Tmpp129 17 71 1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139453
Predicted Effect probably benign
Transcript: ENSMUST00000139518
SMART Domains Protein: ENSMUSP00000144475
Gene: ENSMUSG00000004642

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
low complexity region 105 123 N/A INTRINSIC
Pfam:SLBP_RNA_bind 130 199 3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140931
SMART Domains Protein: ENSMUSP00000114809
Gene: ENSMUSG00000019295

DomainStartEndE-ValueType
Pfam:Tmpp129 17 71 1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148153
Predicted Effect probably benign
Transcript: ENSMUST00000151081
Predicted Effect probably benign
Transcript: ENSMUST00000152847
Predicted Effect probably benign
Transcript: ENSMUST00000200849
SMART Domains Protein: ENSMUSP00000144662
Gene: ENSMUSG00000019295

DomainStartEndE-ValueType
Pfam:Tmpp129 1 73 1.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201633
SMART Domains Protein: ENSMUSP00000144567
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
internal_repeat_1 34 102 8.87e-21 PROSPERO
internal_repeat_1 130 198 8.87e-21 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202708
Meta Mutation Damage Score 0.2514 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,298,481 I2743V probably benign Het
Adamts16 A G 13: 70,791,794 probably benign Het
Adgrb1 A G 15: 74,587,149 I427V probably benign Het
Apopt1 T C 12: 111,733,658 probably benign Het
Arhgef1 T A 7: 24,921,957 F510I possibly damaging Het
B3glct A G 5: 149,746,592 D342G probably damaging Het
Bcl2a1c G T 9: 114,330,285 V44F probably damaging Het
Brca1 A G 11: 101,523,993 V1105A probably benign Het
Cep135 A G 5: 76,601,502 H272R probably benign Het
Cog1 A C 11: 113,662,250 H365P probably benign Het
Col12a1 A T 9: 79,702,345 L293Q probably damaging Het
Col18a1 A G 10: 77,058,736 L1493P probably damaging Het
Ctsh A G 9: 90,075,738 Y290C probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb39 G T 8: 19,052,969 H37N possibly damaging Het
Epha3 A G 16: 63,566,648 I875T probably damaging Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fga T C 3: 83,030,857 S180P probably damaging Het
Fndc1 C T 17: 7,765,107 R1329Q unknown Het
Fyn C A 10: 39,526,901 T223K possibly damaging Het
Galnt6 A T 15: 100,699,206 S360T probably damaging Het
Gm10436 T C 12: 88,178,191 I122V probably benign Het
Grsf1 C A 5: 88,663,153 V336F probably damaging Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hivep3 G A 4: 120,103,847 E1700K probably damaging Het
Ifna6 T C 4: 88,827,941 S176P probably damaging Het
Lilr4b T A 10: 51,481,293 L75Q probably benign Het
Lrig3 C T 10: 125,966,705 T77I probably benign Het
Mpped1 C T 15: 83,836,282 P135L probably damaging Het
Mss51 T A 14: 20,483,186 I406F possibly damaging Het
Mybpc2 T C 7: 44,505,616 N956D probably damaging Het
Olfr1197 T C 2: 88,729,154 I148M possibly damaging Het
Podxl2 G A 6: 88,849,595 T243I probably benign Het
Polr2a C T 11: 69,736,893 R1396Q possibly damaging Het
Pygm C T 19: 6,388,758 R205W probably damaging Het
Rfx3 A G 19: 27,806,262 M428T probably benign Het
Ric1 A T 19: 29,587,793 T647S probably damaging Het
Rictor G A 15: 6,776,753 probably null Het
Rnf38 A T 4: 44,152,350 probably benign Het
Slc6a21 T A 7: 45,286,468 I41K probably damaging Het
St8sia4 T A 1: 95,653,558 D153V probably benign Het
Stk33 T C 7: 109,331,474 N226S probably benign Het
Strn3 A G 12: 51,661,608 probably null Het
Tlr6 G T 5: 64,953,946 N539K probably benign Het
Tmem94 A G 11: 115,787,385 I145V probably benign Het
Trap1 A C 16: 4,044,626 V596G probably damaging Het
Tspan2 A G 3: 102,735,027 I11V probably null Het
Ttc23 A T 7: 67,662,483 H46L probably benign Het
Txnip T A 3: 96,559,979 D292E probably benign Het
Vmn1r121 T A 7: 21,098,462 I18F possibly damaging Het
Vmn1r61 G A 7: 5,611,067 H83Y probably benign Het
Vmn1r82 T C 7: 12,305,321 S174P probably benign Het
Vmn2r79 A C 7: 87,002,079 T229P probably benign Het
Vps13b T G 15: 35,455,133 Y729* probably null Het
Wisp2 C A 2: 163,832,322 A214D probably damaging Het
Xdh C T 17: 73,922,463 V332M possibly damaging Het
Xkr5 C A 8: 18,940,636 R205L possibly damaging Het
Zc3h4 T C 7: 16,435,178 S1071P unknown Het
Zc3h6 A G 2: 129,015,412 H617R possibly damaging Het
Zfp597 A G 16: 3,866,379 V171A probably benign Het
Zfp709 T C 8: 71,890,605 F626S probably damaging Het
Zfp944 C A 17: 22,339,028 D413Y probably damaging Het
Zfp979 A C 4: 147,613,135 S372R possibly damaging Het
Other mutations in Tmem129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03048:Tmem129 UTSW 5 33655467 missense possibly damaging 0.90
R0972:Tmem129 UTSW 5 33654768 missense possibly damaging 0.63
R1559:Tmem129 UTSW 5 33657756 unclassified probably null
R1869:Tmem129 UTSW 5 33654499 missense probably damaging 1.00
R1967:Tmem129 UTSW 5 33655321 critical splice donor site probably null
R2050:Tmem129 UTSW 5 33657782 missense probably benign 0.00
R5208:Tmem129 UTSW 5 33655506 missense probably damaging 1.00
R5802:Tmem129 UTSW 5 33657716 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGAACATCCTGTTGCTGAGCC -3'
(R):5'- GAAATAGCTCTTCCCTTCCCCAAGC -3'

Sequencing Primer
(F):5'- GTTGCTGAGCCACATGTACAC -3'
(R):5'- TGCAGGCTACTACATGGGC -3'
Posted On2013-05-09