Mutagenetix > Incidental Mutation

Incidental Mutation 'R0336:Brca1'

34134

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

038545-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0336 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101523993 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1105 (V1105A)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]

AlphaFold

P48754

Predicted Effect

probably benign
Transcript: ENSMUST00000017290
AA Change: V1105A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: V1105A

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131460

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188168

Predicted Effect

probably benign
Transcript: ENSMUST00000191198

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 98.1%
20x: 97.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,298,481	I2743V	probably benign	Het
Adamts16	A	G	13: 70,791,794		probably benign	Het
Adgrb1	A	G	15: 74,587,149	I427V	probably benign	Het
Apopt1	T	C	12: 111,733,658		probably benign	Het
Arhgef1	T	A	7: 24,921,957	F510I	possibly damaging	Het
B3glct	A	G	5: 149,746,592	D342G	probably damaging	Het
Bcl2a1c	G	T	9: 114,330,285	V44F	probably damaging	Het
Cep135	A	G	5: 76,601,502	H272R	probably benign	Het
Cog1	A	C	11: 113,662,250	H365P	probably benign	Het
Col12a1	A	T	9: 79,702,345	L293Q	probably damaging	Het
Col18a1	A	G	10: 77,058,736	L1493P	probably damaging	Het
Ctsh	A	G	9: 90,075,738	Y290C	probably damaging	Het
Dach1	C	T	14: 98,168,748	G188R	probably damaging	Het
Defb39	G	T	8: 19,052,969	H37N	possibly damaging	Het
Epha3	A	G	16: 63,566,648	I875T	probably damaging	Het
Fbrsl1	A	G	5: 110,447,951	S73P	probably damaging	Het
Fga	T	C	3: 83,030,857	S180P	probably damaging	Het
Fndc1	C	T	17: 7,765,107	R1329Q	unknown	Het
Fyn	C	A	10: 39,526,901	T223K	possibly damaging	Het
Galnt6	A	T	15: 100,699,206	S360T	probably damaging	Het
Gm10436	T	C	12: 88,178,191	I122V	probably benign	Het
Grsf1	C	A	5: 88,663,153	V336F	probably damaging	Het
Hip1	A	T	5: 135,428,613	Y720N	probably benign	Het
Hivep3	G	A	4: 120,103,847	E1700K	probably damaging	Het
Ifna6	T	C	4: 88,827,941	S176P	probably damaging	Het
Lilr4b	T	A	10: 51,481,293	L75Q	probably benign	Het
Lrig3	C	T	10: 125,966,705	T77I	probably benign	Het
Mpped1	C	T	15: 83,836,282	P135L	probably damaging	Het
Mss51	T	A	14: 20,483,186	I406F	possibly damaging	Het
Mybpc2	T	C	7: 44,505,616	N956D	probably damaging	Het
Olfr1197	T	C	2: 88,729,154	I148M	possibly damaging	Het
Podxl2	G	A	6: 88,849,595	T243I	probably benign	Het
Polr2a	C	T	11: 69,736,893	R1396Q	possibly damaging	Het
Pygm	C	T	19: 6,388,758	R205W	probably damaging	Het
Rfx3	A	G	19: 27,806,262	M428T	probably benign	Het
Ric1	A	T	19: 29,587,793	T647S	probably damaging	Het
Rictor	G	A	15: 6,776,753		probably null	Het
Rnf38	A	T	4: 44,152,350		probably benign	Het
Slc6a21	T	A	7: 45,286,468	I41K	probably damaging	Het
St8sia4	T	A	1: 95,653,558	D153V	probably benign	Het
Stk33	T	C	7: 109,331,474	N226S	probably benign	Het
Strn3	A	G	12: 51,661,608		probably null	Het
Tlr6	G	T	5: 64,953,946	N539K	probably benign	Het
Tmem129	G	T	5: 33,655,602	P134Q	probably damaging	Het
Tmem94	A	G	11: 115,787,385	I145V	probably benign	Het
Trap1	A	C	16: 4,044,626	V596G	probably damaging	Het
Tspan2	A	G	3: 102,735,027	I11V	probably null	Het
Ttc23	A	T	7: 67,662,483	H46L	probably benign	Het
Txnip	T	A	3: 96,559,979	D292E	probably benign	Het
Vmn1r121	T	A	7: 21,098,462	I18F	possibly damaging	Het
Vmn1r61	G	A	7: 5,611,067	H83Y	probably benign	Het
Vmn1r82	T	C	7: 12,305,321	S174P	probably benign	Het
Vmn2r79	A	C	7: 87,002,079	T229P	probably benign	Het
Vps13b	T	G	15: 35,455,133	Y729*	probably null	Het
Wisp2	C	A	2: 163,832,322	A214D	probably damaging	Het
Xdh	C	T	17: 73,922,463	V332M	possibly damaging	Het
Xkr5	C	A	8: 18,940,636	R205L	possibly damaging	Het
Zc3h4	T	C	7: 16,435,178	S1071P	unknown	Het
Zc3h6	A	G	2: 129,015,412	H617R	possibly damaging	Het
Zfp597	A	G	16: 3,866,379	V171A	probably benign	Het
Zfp709	T	C	8: 71,890,605	F626S	probably damaging	Het
Zfp944	C	A	17: 22,339,028	D413Y	probably damaging	Het
Zfp979	A	C	4: 147,613,135	S372R	possibly damaging	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00
R9616:Brca1	UTSW	11	101525857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGATGCATGGGTTACAGGACTAGG -3'
(R):5'- ATCATCAACTGAGATGGCGGTGGG -3'

Sequencing Primer
(F):5'- TTACAGGACTAGGGCTCCTACTG -3'
(R):5'- TCCTTCCCAGGACAACTAGGTAG -3'

Posted On

2013-05-09