Incidental Mutation 'R0336:Rfx3'
ID34155
Institutional Source Beutler Lab
Gene Symbol Rfx3
Ensembl Gene ENSMUSG00000040929
Gene Nameregulatory factor X, 3 (influences HLA class II expression)
SynonymsC230093O12Rik, MRFX3
MMRRC Submission 038545-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0336 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location27761721-28011166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27806262 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 428 (M428T)
Ref Sequence ENSEMBL: ENSMUSP00000133461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046898] [ENSMUST00000165566] [ENSMUST00000172907] [ENSMUST00000173863] [ENSMUST00000174850]
Predicted Effect probably benign
Transcript: ENSMUST00000046898
AA Change: M403T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000038760
Gene: ENSMUSG00000040929
AA Change: M403T

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 6.3e-58 PFAM
Pfam:RFX_DNA_binding 150 235 6.9e-41 PFAM
low complexity region 274 283 N/A INTRINSIC
internal_repeat_1 326 414 1.39e-5 PROSPERO
internal_repeat_1 439 527 1.39e-5 PROSPERO
low complexity region 649 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165566
AA Change: M428T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000126313
Gene: ENSMUSG00000040929
AA Change: M428T

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 138 9.7e-38 PFAM
Pfam:RFX_DNA_binding 181 258 6.2e-36 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172498
Predicted Effect probably benign
Transcript: ENSMUST00000172907
AA Change: M428T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000134141
Gene: ENSMUSG00000040929
AA Change: M428T

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 9.4e-58 PFAM
Pfam:RFX_DNA_binding 175 260 5.2e-41 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173161
Predicted Effect probably benign
Transcript: ENSMUST00000173863
SMART Domains Protein: ENSMUSP00000133367
Gene: ENSMUSG00000040929

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 3.3e-58 PFAM
Pfam:RFX_DNA_binding 175 246 3.7e-24 PFAM
low complexity region 285 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174850
AA Change: M428T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000133461
Gene: ENSMUSG00000040929
AA Change: M428T

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 9.4e-58 PFAM
Pfam:RFX_DNA_binding 175 260 5.2e-41 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display embryonic and perinatal lethality, impaired development of cilia on the embryonic node, abnormal left-right patterning, meso- and dextrocardia, and situs inversus in surviving adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,298,481 I2743V probably benign Het
Adamts16 A G 13: 70,791,794 probably benign Het
Adgrb1 A G 15: 74,587,149 I427V probably benign Het
Apopt1 T C 12: 111,733,658 probably benign Het
Arhgef1 T A 7: 24,921,957 F510I possibly damaging Het
B3glct A G 5: 149,746,592 D342G probably damaging Het
Bcl2a1c G T 9: 114,330,285 V44F probably damaging Het
Brca1 A G 11: 101,523,993 V1105A probably benign Het
Cep135 A G 5: 76,601,502 H272R probably benign Het
Cog1 A C 11: 113,662,250 H365P probably benign Het
Col12a1 A T 9: 79,702,345 L293Q probably damaging Het
Col18a1 A G 10: 77,058,736 L1493P probably damaging Het
Ctsh A G 9: 90,075,738 Y290C probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb39 G T 8: 19,052,969 H37N possibly damaging Het
Epha3 A G 16: 63,566,648 I875T probably damaging Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fga T C 3: 83,030,857 S180P probably damaging Het
Fndc1 C T 17: 7,765,107 R1329Q unknown Het
Fyn C A 10: 39,526,901 T223K possibly damaging Het
Galnt6 A T 15: 100,699,206 S360T probably damaging Het
Gm10436 T C 12: 88,178,191 I122V probably benign Het
Grsf1 C A 5: 88,663,153 V336F probably damaging Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hivep3 G A 4: 120,103,847 E1700K probably damaging Het
Ifna6 T C 4: 88,827,941 S176P probably damaging Het
Lilr4b T A 10: 51,481,293 L75Q probably benign Het
Lrig3 C T 10: 125,966,705 T77I probably benign Het
Mpped1 C T 15: 83,836,282 P135L probably damaging Het
Mss51 T A 14: 20,483,186 I406F possibly damaging Het
Mybpc2 T C 7: 44,505,616 N956D probably damaging Het
Olfr1197 T C 2: 88,729,154 I148M possibly damaging Het
Podxl2 G A 6: 88,849,595 T243I probably benign Het
Polr2a C T 11: 69,736,893 R1396Q possibly damaging Het
Pygm C T 19: 6,388,758 R205W probably damaging Het
Ric1 A T 19: 29,587,793 T647S probably damaging Het
Rictor G A 15: 6,776,753 probably null Het
Rnf38 A T 4: 44,152,350 probably benign Het
Slc6a21 T A 7: 45,286,468 I41K probably damaging Het
St8sia4 T A 1: 95,653,558 D153V probably benign Het
Stk33 T C 7: 109,331,474 N226S probably benign Het
Strn3 A G 12: 51,661,608 probably null Het
Tlr6 G T 5: 64,953,946 N539K probably benign Het
Tmem129 G T 5: 33,655,602 P134Q probably damaging Het
Tmem94 A G 11: 115,787,385 I145V probably benign Het
Trap1 A C 16: 4,044,626 V596G probably damaging Het
Tspan2 A G 3: 102,735,027 I11V probably null Het
Ttc23 A T 7: 67,662,483 H46L probably benign Het
Txnip T A 3: 96,559,979 D292E probably benign Het
Vmn1r121 T A 7: 21,098,462 I18F possibly damaging Het
Vmn1r61 G A 7: 5,611,067 H83Y probably benign Het
Vmn1r82 T C 7: 12,305,321 S174P probably benign Het
Vmn2r79 A C 7: 87,002,079 T229P probably benign Het
Vps13b T G 15: 35,455,133 Y729* probably null Het
Wisp2 C A 2: 163,832,322 A214D probably damaging Het
Xdh C T 17: 73,922,463 V332M possibly damaging Het
Xkr5 C A 8: 18,940,636 R205L possibly damaging Het
Zc3h4 T C 7: 16,435,178 S1071P unknown Het
Zc3h6 A G 2: 129,015,412 H617R possibly damaging Het
Zfp597 A G 16: 3,866,379 V171A probably benign Het
Zfp709 T C 8: 71,890,605 F626S probably damaging Het
Zfp944 C A 17: 22,339,028 D413Y probably damaging Het
Zfp979 A C 4: 147,613,135 S372R possibly damaging Het
Other mutations in Rfx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Rfx3 APN 19 27806186 critical splice donor site probably null
IGL00588:Rfx3 APN 19 27826076 nonsense probably null
IGL01408:Rfx3 APN 19 27768650 missense probably benign 0.04
IGL01937:Rfx3 APN 19 27830729 missense probably damaging 1.00
IGL02668:Rfx3 APN 19 27815614 splice site probably benign
IGL02679:Rfx3 APN 19 27849737 missense possibly damaging 0.95
R0267:Rfx3 UTSW 19 27793788 missense probably benign 0.00
R0838:Rfx3 UTSW 19 27849967 missense possibly damaging 0.92
R0967:Rfx3 UTSW 19 27806351 splice site probably benign
R1102:Rfx3 UTSW 19 27867600 missense possibly damaging 0.51
R1507:Rfx3 UTSW 19 27768513 missense probably benign 0.00
R2172:Rfx3 UTSW 19 27815494 nonsense probably null
R2844:Rfx3 UTSW 19 27806786 splice site probably benign
R2960:Rfx3 UTSW 19 27900811 nonsense probably null
R4291:Rfx3 UTSW 19 27800232 missense probably damaging 1.00
R4952:Rfx3 UTSW 19 27830672 missense probably damaging 1.00
R5198:Rfx3 UTSW 19 27830776 missense probably damaging 1.00
R5451:Rfx3 UTSW 19 27849959 missense probably damaging 1.00
R5590:Rfx3 UTSW 19 27802380 critical splice donor site probably null
R5641:Rfx3 UTSW 19 27793608 splice site probably null
R5663:Rfx3 UTSW 19 27793617 missense probably damaging 1.00
R5899:Rfx3 UTSW 19 27830765 missense probably damaging 1.00
R6049:Rfx3 UTSW 19 27802395 missense probably damaging 0.99
R6368:Rfx3 UTSW 19 27768609 missense possibly damaging 0.92
R7131:Rfx3 UTSW 19 27768628 nonsense probably null
R7273:Rfx3 UTSW 19 27802458 missense probably damaging 1.00
Z1088:Rfx3 UTSW 19 27837450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCAGTTCCCCTTCACTGCAATG -3'
(R):5'- CCAGCCATATGACACCAGTGCAATG -3'

Sequencing Primer
(F):5'- TCACTGCAATGTCACTCTAAGC -3'
(R):5'- CACCAGTGCAATGATGGTATAGTTC -3'
Posted On2013-05-09