Incidental Mutation 'R0336:Ric1'
Institutional Source Beutler Lab
Gene Symbol Ric1
Ensembl Gene ENSMUSG00000038658
Gene NameRAB6A GEF complex partner 1
SynonymsC030046E11Rik, C130057E09Rik
MMRRC Submission 038545-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R0336 (G1)
Quality Score225
Status Validated
Chromosomal Location29522282-29606829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29587793 bp
Amino Acid Change Threonine to Serine at position 647 (T647S)
Ref Sequence ENSEMBL: ENSMUSP00000043437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043610]
Predicted Effect probably damaging
Transcript: ENSMUST00000043610
AA Change: T647S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: T647S

Blast:WD40 242 278 5e-7 BLAST
SCOP:d1gxra_ 254 379 2e-4 SMART
Blast:WD40 285 334 3e-6 BLAST
Blast:WD40 482 520 5e-6 BLAST
low complexity region 642 653 N/A INTRINSIC
Pfam:RIC1 732 991 1.9e-86 PFAM
low complexity region 1120 1132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162492
AA Change: T538S
SMART Domains Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: T538S

Blast:WD40 171 207 4e-7 BLAST
SCOP:d1gxra_ 183 308 2e-4 SMART
Blast:WD40 214 263 2e-6 BLAST
low complexity region 534 545 N/A INTRINSIC
Pfam:RIC1 624 883 1.6e-86 PFAM
low complexity region 1012 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.1415 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,298,481 I2743V probably benign Het
Adamts16 A G 13: 70,791,794 probably benign Het
Adgrb1 A G 15: 74,587,149 I427V probably benign Het
Apopt1 T C 12: 111,733,658 probably benign Het
Arhgef1 T A 7: 24,921,957 F510I possibly damaging Het
B3glct A G 5: 149,746,592 D342G probably damaging Het
Bcl2a1c G T 9: 114,330,285 V44F probably damaging Het
Brca1 A G 11: 101,523,993 V1105A probably benign Het
Cep135 A G 5: 76,601,502 H272R probably benign Het
Cog1 A C 11: 113,662,250 H365P probably benign Het
Col12a1 A T 9: 79,702,345 L293Q probably damaging Het
Col18a1 A G 10: 77,058,736 L1493P probably damaging Het
Ctsh A G 9: 90,075,738 Y290C probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb39 G T 8: 19,052,969 H37N possibly damaging Het
Epha3 A G 16: 63,566,648 I875T probably damaging Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fga T C 3: 83,030,857 S180P probably damaging Het
Fndc1 C T 17: 7,765,107 R1329Q unknown Het
Fyn C A 10: 39,526,901 T223K possibly damaging Het
Galnt6 A T 15: 100,699,206 S360T probably damaging Het
Gm10436 T C 12: 88,178,191 I122V probably benign Het
Grsf1 C A 5: 88,663,153 V336F probably damaging Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hivep3 G A 4: 120,103,847 E1700K probably damaging Het
Ifna6 T C 4: 88,827,941 S176P probably damaging Het
Lilr4b T A 10: 51,481,293 L75Q probably benign Het
Lrig3 C T 10: 125,966,705 T77I probably benign Het
Mpped1 C T 15: 83,836,282 P135L probably damaging Het
Mss51 T A 14: 20,483,186 I406F possibly damaging Het
Mybpc2 T C 7: 44,505,616 N956D probably damaging Het
Olfr1197 T C 2: 88,729,154 I148M possibly damaging Het
Podxl2 G A 6: 88,849,595 T243I probably benign Het
Polr2a C T 11: 69,736,893 R1396Q possibly damaging Het
Pygm C T 19: 6,388,758 R205W probably damaging Het
Rfx3 A G 19: 27,806,262 M428T probably benign Het
Rictor G A 15: 6,776,753 probably null Het
Rnf38 A T 4: 44,152,350 probably benign Het
Slc6a21 T A 7: 45,286,468 I41K probably damaging Het
St8sia4 T A 1: 95,653,558 D153V probably benign Het
Stk33 T C 7: 109,331,474 N226S probably benign Het
Strn3 A G 12: 51,661,608 probably null Het
Tlr6 G T 5: 64,953,946 N539K probably benign Het
Tmem129 G T 5: 33,655,602 P134Q probably damaging Het
Tmem94 A G 11: 115,787,385 I145V probably benign Het
Trap1 A C 16: 4,044,626 V596G probably damaging Het
Tspan2 A G 3: 102,735,027 I11V probably null Het
Ttc23 A T 7: 67,662,483 H46L probably benign Het
Txnip T A 3: 96,559,979 D292E probably benign Het
Vmn1r121 T A 7: 21,098,462 I18F possibly damaging Het
Vmn1r61 G A 7: 5,611,067 H83Y probably benign Het
Vmn1r82 T C 7: 12,305,321 S174P probably benign Het
Vmn2r79 A C 7: 87,002,079 T229P probably benign Het
Vps13b T G 15: 35,455,133 Y729* probably null Het
Wisp2 C A 2: 163,832,322 A214D probably damaging Het
Xdh C T 17: 73,922,463 V332M possibly damaging Het
Xkr5 C A 8: 18,940,636 R205L possibly damaging Het
Zc3h4 T C 7: 16,435,178 S1071P unknown Het
Zc3h6 A G 2: 129,015,412 H617R possibly damaging Het
Zfp597 A G 16: 3,866,379 V171A probably benign Het
Zfp709 T C 8: 71,890,605 F626S probably damaging Het
Zfp944 C A 17: 22,339,028 D413Y probably damaging Het
Zfp979 A C 4: 147,613,135 S372R possibly damaging Het
Other mutations in Ric1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Ric1 APN 19 29595362 missense probably damaging 1.00
IGL00902:Ric1 APN 19 29567231 missense probably benign 0.05
IGL01405:Ric1 APN 19 29567370 splice site probably benign
IGL01629:Ric1 APN 19 29603981 missense probably benign 0.02
IGL01688:Ric1 APN 19 29577614 missense probably benign 0.00
IGL01966:Ric1 APN 19 29595563 missense probably benign 0.33
IGL02123:Ric1 APN 19 29594800 missense probably benign
IGL02590:Ric1 APN 19 29567481 splice site probably benign
IGL02655:Ric1 APN 19 29595451 missense probably damaging 1.00
IGL02699:Ric1 APN 19 29522557 missense possibly damaging 0.51
IGL02718:Ric1 APN 19 29533240 missense probably damaging 1.00
IGL03026:Ric1 APN 19 29599833 missense probably benign 0.02
IGL03142:Ric1 APN 19 29600980 missense possibly damaging 0.89
R0109:Ric1 UTSW 19 29586677 synonymous silent
R0362:Ric1 UTSW 19 29601011 critical splice donor site probably null
R0676:Ric1 UTSW 19 29577647 missense probably benign
R0734:Ric1 UTSW 19 29594818 missense possibly damaging 0.66
R1004:Ric1 UTSW 19 29602357 missense probably benign 0.00
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1216:Ric1 UTSW 19 29577735 missense probably benign 0.00
R1493:Ric1 UTSW 19 29579849 missense probably benign
R1848:Ric1 UTSW 19 29600813 splice site probably null
R1872:Ric1 UTSW 19 29602668 missense probably benign 0.32
R1942:Ric1 UTSW 19 29601016 splice site probably benign
R2143:Ric1 UTSW 19 29533252 missense probably damaging 1.00
R2143:Ric1 UTSW 19 29533253 missense probably damaging 0.96
R2679:Ric1 UTSW 19 29604030 missense probably benign
R2878:Ric1 UTSW 19 29602330 missense possibly damaging 0.77
R2970:Ric1 UTSW 19 29577718 missense probably benign 0.15
R3420:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3421:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3940:Ric1 UTSW 19 29570762 missense probably damaging 1.00
R4004:Ric1 UTSW 19 29579801 missense probably benign 0.44
R4225:Ric1 UTSW 19 29602731 missense possibly damaging 0.89
R4280:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4283:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4516:Ric1 UTSW 19 29570765 missense probably benign 0.17
R4702:Ric1 UTSW 19 29598017 missense possibly damaging 0.85
R4824:Ric1 UTSW 19 29585842 missense probably damaging 1.00
R4835:Ric1 UTSW 19 29595536 missense possibly damaging 0.80
R5860:Ric1 UTSW 19 29599845 missense possibly damaging 0.91
R5883:Ric1 UTSW 19 29595989 missense probably damaging 1.00
R5965:Ric1 UTSW 19 29570771 missense probably damaging 0.99
R6141:Ric1 UTSW 19 29595442 missense probably damaging 1.00
R6236:Ric1 UTSW 19 29595426 missense possibly damaging 0.91
R6271:Ric1 UTSW 19 29567365 splice site probably null
R6345:Ric1 UTSW 19 29604085 missense probably benign 0.09
R6371:Ric1 UTSW 19 29562026 missense probably benign 0.35
R6547:Ric1 UTSW 19 29594826 missense probably damaging 1.00
R6924:Ric1 UTSW 19 29569388 missense probably damaging 0.98
R6969:Ric1 UTSW 19 29585782 missense probably damaging 1.00
R6970:Ric1 UTSW 19 29587772 missense probably damaging 1.00
R6993:Ric1 UTSW 19 29586613 missense probably damaging 1.00
R7296:Ric1 UTSW 19 29584578 critical splice donor site probably null
R7434:Ric1 UTSW 19 29574780 missense probably damaging 1.00
R7619:Ric1 UTSW 19 29579775 missense probably benign 0.32
R7850:Ric1 UTSW 19 29594893 missense probably benign
R7933:Ric1 UTSW 19 29594893 missense probably benign
X0064:Ric1 UTSW 19 29587802 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gagggcatcagatcccattac -3'
Posted On2013-05-09