Incidental Mutation 'R0316:Dll4'
ID34167
Institutional Source Beutler Lab
Gene Symbol Dll4
Ensembl Gene ENSMUSG00000027314
Gene Namedelta like canonical Notch ligand 4
SynonymsDelta4
MMRRC Submission 038526-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0316 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119325784-119335962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119331153 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 405 (D405E)
Ref Sequence ENSEMBL: ENSMUSP00000099575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102517]
Predicted Effect probably damaging
Transcript: ENSMUST00000102517
AA Change: D405E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099575
Gene: ENSMUSG00000027314
AA Change: D405E

DomainStartEndE-ValueType
Pfam:MNNL 27 92 7.3e-21 PFAM
low complexity region 139 150 N/A INTRINSIC
DSL 156 218 1.98e-23 SMART
EGF 222 252 5.62e0 SMART
EGF 253 283 5.79e-2 SMART
EGF_CA 285 323 1.38e-8 SMART
EGF_CA 329 361 5.36e-6 SMART
EGF 366 401 4.35e-6 SMART
EGF 406 439 1.44e-6 SMART
EGF_CA 441 477 2.33e-6 SMART
EGF 484 519 9.33e-6 SMART
transmembrane domain 530 552 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156538
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, absent vascular remodeling, small hearts, and embryonic growth retardation. Heterozygous null mice display background dependent partial or complete embryonic lethality, impaired vascular remodeling, and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,369 F276I probably damaging Het
Ado A G 10: 67,548,718 L19P possibly damaging Het
Ago2 T C 15: 73,130,876 H169R probably damaging Het
Asic1 G A 15: 99,671,938 A47T probably benign Het
Atg16l2 A T 7: 101,293,396 I364N probably damaging Het
C130050O18Rik G A 5: 139,414,558 R122Q probably damaging Het
Capn7 T A 14: 31,347,809 C197S probably benign Het
Casp16-ps T C 17: 23,552,092 D113G probably damaging Het
Cdh18 T A 15: 23,366,913 V235D probably damaging Het
Clca4a G T 3: 144,953,764 T777K probably damaging Het
Col17a1 A G 19: 47,685,533 probably null Het
Col5a3 C A 9: 20,775,325 D1335Y unknown Het
Cpxm1 T C 2: 130,393,171 E576G probably damaging Het
Dcbld2 T C 16: 58,433,445 S182P probably damaging Het
Dclk1 C T 3: 55,502,892 S616L probably damaging Het
Dgcr14 G A 16: 17,910,094 P103S probably benign Het
Dnah1 G A 14: 31,278,151 R2462C probably benign Het
Dnah3 A T 7: 119,965,659 Y2594N possibly damaging Het
Fam110a C A 2: 151,970,086 A255S probably benign Het
Fbn2 G A 18: 58,113,325 R502W probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Gm1527 T C 3: 28,915,774 S342P probably damaging Het
Gm19668 A T 10: 77,798,730 probably benign Het
Gm5901 A T 7: 105,377,315 T97S probably damaging Het
Greb1l A G 18: 10,547,420 Y1546C probably damaging Het
Impg1 A T 9: 80,342,065 S619T probably damaging Het
Itih2 C A 2: 10,105,246 Q565H possibly damaging Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lama3 T C 18: 12,519,877 M218T probably benign Het
Lipg T C 18: 74,960,941 S12G probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mex3d G T 10: 80,381,671 P571T probably damaging Het
Neb A C 2: 52,195,470 Y1538D possibly damaging Het
Nsd1 T C 13: 55,213,771 I184T probably damaging Het
Olfr1143 T C 2: 87,803,181 F264S probably damaging Het
Olfr1451 T A 19: 12,999,402 C139S probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pacs1 T C 19: 5,135,121 silent Het
Pdcd11 T C 19: 47,113,172 V932A probably damaging Het
Pkd2 A G 5: 104,477,166 D276G probably damaging Het
Pkia T A 3: 7,437,439 D25E probably damaging Het
Plxna2 A C 1: 194,644,150 S131R probably damaging Het
Prelid1 T C 13: 55,324,407 V132A possibly damaging Het
Psma3 T C 12: 70,983,389 Y59H probably benign Het
Ptchd3 A C 11: 121,842,090 E602A possibly damaging Het
Ptpro T C 6: 137,376,989 V121A possibly damaging Het
Ptprt A G 2: 161,607,319 L878P probably damaging Het
Pxn G A 5: 115,553,968 G370S probably damaging Het
Rcn2 G T 9: 56,042,169 A40S probably benign Het
Rnf215 A G 11: 4,139,760 N258D probably damaging Het
Rnpc3 T C 3: 113,629,973 T28A probably damaging Het
Rtel1 T A 2: 181,356,002 V1100E possibly damaging Het
Scn3a T A 2: 65,460,829 I1858F probably damaging Het
Slc9c1 G A 16: 45,580,232 R735Q possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata13 A G 14: 60,692,339 T449A probably benign Het
Svep1 A G 4: 58,072,737 W2191R probably damaging Het
Thbs1 G A 2: 118,117,574 R405H probably damaging Het
Tnn A G 1: 160,120,567 Y859H possibly damaging Het
Tonsl A G 15: 76,629,300 S1245P possibly damaging Het
Tpcn1 G A 5: 120,539,259 T661M probably damaging Het
Trap1 A G 16: 4,045,560 F533L probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Vax2 T C 6: 83,711,444 S50P possibly damaging Het
Vmn1r5 A C 6: 56,985,799 E153A probably benign Het
Vmn2r14 G T 5: 109,218,896 P486Q probably benign Het
Vmn2r96 T A 17: 18,582,565 F246I probably damaging Het
Zc3h10 C A 10: 128,544,755 E244D probably damaging Het
Zdhhc18 T A 4: 133,613,655 K265* probably null Het
Other mutations in Dll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Dll4 APN 2 119331109 missense probably damaging 1.00
IGL01149:Dll4 APN 2 119332745 missense probably damaging 1.00
IGL02511:Dll4 APN 2 119326466 missense probably damaging 0.99
PIT4519001:Dll4 UTSW 2 119332416 missense probably benign 0.01
R0725:Dll4 UTSW 2 119332689 missense probably damaging 1.00
R0840:Dll4 UTSW 2 119326485 missense probably benign 0.01
R1014:Dll4 UTSW 2 119331157 missense probably damaging 1.00
R1650:Dll4 UTSW 2 119331130 missense probably damaging 1.00
R3813:Dll4 UTSW 2 119331029 missense possibly damaging 0.65
R3974:Dll4 UTSW 2 119334092 missense probably damaging 0.98
R5320:Dll4 UTSW 2 119326487 missense probably damaging 0.97
R6166:Dll4 UTSW 2 119334626 critical splice acceptor site probably null
R6305:Dll4 UTSW 2 119330657 missense probably benign 0.01
R6455:Dll4 UTSW 2 119333795 splice site probably null
R6617:Dll4 UTSW 2 119327931 missense probably benign
R6843:Dll4 UTSW 2 119325994 start gained probably benign
R7204:Dll4 UTSW 2 119328573 missense probably damaging 0.98
R7251:Dll4 UTSW 2 119332292 missense probably damaging 1.00
Z1176:Dll4 UTSW 2 119326052 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGGTAGCATCCAGTCAGTGTG -3'
(R):5'- AACCAAAGAGGAGCCTGTTTCAGTC -3'

Sequencing Primer
(F):5'- GAGAATAGCTACCACTGCCTGTG -3'
(R):5'- TTTCAGTCAGCCTGACCACAATAG -3'
Posted On2013-05-09