Mutagenetix > Incidental Mutation

Incidental Mutation 'R0316:Ptprt'

34170

Institutional Source

Beutler Lab

Gene Symbol

Ptprt

Ensembl Gene

ENSMUSG00000053141

Gene Name

protein tyrosine phosphatase, receptor type, T

Synonyms

RPTPrho

MMRRC Submission

038526-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R0316 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

161521990-162661147 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 161607319 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 878 (L878P)

Ref Sequence

ENSEMBL: ENSMUSP00000105069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000109441
AA Change: L868P

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: L868P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1159	3.64e-129	SMART
PTPc	1188	1453	4.24e-98	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109442
AA Change: L887P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: L887P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	738	749	N/A	INTRINSIC
transmembrane domain	772	791	N/A	INTRINSIC
PTPc	901	1158	5.56e-134	SMART
PTPc	1187	1452	4.24e-98	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109443
AA Change: L878P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: L878P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	778	792	N/A	INTRINSIC
PTPc	892	1149	5.56e-134	SMART
PTPc	1178	1443	4.24e-98	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109445
AA Change: L868P

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: L868P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1139	5.56e-134	SMART
PTPc	1168	1433	4.24e-98	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,025,369	F276I	probably damaging	Het
Ado	A	G	10: 67,548,718	L19P	possibly damaging	Het
Ago2	T	C	15: 73,130,876	H169R	probably damaging	Het
Asic1	G	A	15: 99,671,938	A47T	probably benign	Het
Atg16l2	A	T	7: 101,293,396	I364N	probably damaging	Het
C130050O18Rik	G	A	5: 139,414,558	R122Q	probably damaging	Het
Capn7	T	A	14: 31,347,809	C197S	probably benign	Het
Casp16-ps	T	C	17: 23,552,092	D113G	probably damaging	Het
Cdh18	T	A	15: 23,366,913	V235D	probably damaging	Het
Clca4a	G	T	3: 144,953,764	T777K	probably damaging	Het
Col17a1	A	G	19: 47,685,533		probably null	Het
Col5a3	C	A	9: 20,775,325	D1335Y	unknown	Het
Cpxm1	T	C	2: 130,393,171	E576G	probably damaging	Het
Dcbld2	T	C	16: 58,433,445	S182P	probably damaging	Het
Dclk1	C	T	3: 55,502,892	S616L	probably damaging	Het
Dgcr14	G	A	16: 17,910,094	P103S	probably benign	Het
Dll4	C	A	2: 119,331,153	D405E	probably damaging	Het
Dnah1	G	A	14: 31,278,151	R2462C	probably benign	Het
Dnah3	A	T	7: 119,965,659	Y2594N	possibly damaging	Het
Fam110a	C	A	2: 151,970,086	A255S	probably benign	Het
Fbn2	G	A	18: 58,113,325	R502W	probably damaging	Het
Fgl2	A	G	5: 21,375,523	S288G	possibly damaging	Het
Gm1527	T	C	3: 28,915,774	S342P	probably damaging	Het
Gm19668	A	T	10: 77,798,730		probably benign	Het
Gm5901	A	T	7: 105,377,315	T97S	probably damaging	Het
Greb1l	A	G	18: 10,547,420	Y1546C	probably damaging	Het
Impg1	A	T	9: 80,342,065	S619T	probably damaging	Het
Itih2	C	A	2: 10,105,246	Q565H	possibly damaging	Het
Kbtbd6	T	A	14: 79,453,024	N386K	probably benign	Het
Lama3	T	C	18: 12,519,877	M218T	probably benign	Het
Lipg	T	C	18: 74,960,941	S12G	probably benign	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mex3d	G	T	10: 80,381,671	P571T	probably damaging	Het
Neb	A	C	2: 52,195,470	Y1538D	possibly damaging	Het
Nsd1	T	C	13: 55,213,771	I184T	probably damaging	Het
Olfr1143	T	C	2: 87,803,181	F264S	probably damaging	Het
Olfr1451	T	A	19: 12,999,402	C139S	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pacs1	T	C	19: 5,135,121		silent	Het
Pdcd11	T	C	19: 47,113,172	V932A	probably damaging	Het
Pkd2	A	G	5: 104,477,166	D276G	probably damaging	Het
Pkia	T	A	3: 7,437,439	D25E	probably damaging	Het
Plxna2	A	C	1: 194,644,150	S131R	probably damaging	Het
Prelid1	T	C	13: 55,324,407	V132A	possibly damaging	Het
Psma3	T	C	12: 70,983,389	Y59H	probably benign	Het
Ptchd3	A	C	11: 121,842,090	E602A	possibly damaging	Het
Ptpro	T	C	6: 137,376,989	V121A	possibly damaging	Het
Pxn	G	A	5: 115,553,968	G370S	probably damaging	Het
Rcn2	G	T	9: 56,042,169	A40S	probably benign	Het
Rnf215	A	G	11: 4,139,760	N258D	probably damaging	Het
Rnpc3	T	C	3: 113,629,973	T28A	probably damaging	Het
Rtel1	T	A	2: 181,356,002	V1100E	possibly damaging	Het
Scn3a	T	A	2: 65,460,829	I1858F	probably damaging	Het
Slc9c1	G	A	16: 45,580,232	R735Q	possibly damaging	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Spata13	A	G	14: 60,692,339	T449A	probably benign	Het
Svep1	A	G	4: 58,072,737	W2191R	probably damaging	Het
Thbs1	G	A	2: 118,117,574	R405H	probably damaging	Het
Tnn	A	G	1: 160,120,567	Y859H	possibly damaging	Het
Tonsl	A	G	15: 76,629,300	S1245P	possibly damaging	Het
Tpcn1	G	A	5: 120,539,259	T661M	probably damaging	Het
Trap1	A	G	16: 4,045,560	F533L	probably benign	Het
Ttc23	T	C	7: 67,679,073		probably null	Het
Vax2	T	C	6: 83,711,444	S50P	possibly damaging	Het
Vmn1r5	A	C	6: 56,985,799	E153A	probably benign	Het
Vmn2r14	G	T	5: 109,218,896	P486Q	probably benign	Het
Vmn2r96	T	A	17: 18,582,565	F246I	probably damaging	Het
Zc3h10	C	A	10: 128,544,755	E244D	probably damaging	Het
Zdhhc18	T	A	4: 133,613,655	K265*	probably null	Het

Other mutations in Ptprt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ptprt	APN	2	161810624	missense	probably benign	0.00
IGL00565:Ptprt	APN	2	161560191	missense	probably damaging	1.00
IGL00925:Ptprt	APN	2	161656163	missense	possibly damaging	0.52
IGL01344:Ptprt	APN	2	161551817	missense	probably damaging	1.00
IGL01432:Ptprt	APN	2	162268079	splice site	probably benign
IGL02008:Ptprt	APN	2	161927673	missense	probably benign	0.02
IGL02040:Ptprt	APN	2	162238072	missense	probably damaging	1.00
IGL02172:Ptprt	APN	2	161555502	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162238060	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162278046	critical splice donor site	probably null
IGL02232:Ptprt	APN	2	161530517	missense	probably damaging	0.96
IGL02277:Ptprt	APN	2	161547381	missense	probably damaging	1.00
IGL02447:Ptprt	APN	2	162278107	missense	probably benign	0.01
IGL02601:Ptprt	APN	2	161766307	missense	probably benign	0.10
IGL02623:Ptprt	APN	2	161607452	splice site	probably benign
IGL03379:Ptprt	APN	2	161555459	nonsense	probably null
Poverina	UTSW	2	161901497	missense	possibly damaging	0.70
IGL03055:Ptprt	UTSW	2	161533613	missense	probably damaging	0.96
R0064:Ptprt	UTSW	2	161927791	splice site	probably benign
R0129:Ptprt	UTSW	2	162278070	missense	probably benign	0.35
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0132:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0454:Ptprt	UTSW	2	161553822	missense	probably damaging	0.96
R0488:Ptprt	UTSW	2	161553825	missense	probably damaging	0.99
R0573:Ptprt	UTSW	2	161551748	missense	probably damaging	1.00
R0614:Ptprt	UTSW	2	161812120	missense	possibly damaging	0.59
R0834:Ptprt	UTSW	2	161812139	splice site	probably null
R1023:Ptprt	UTSW	2	161558943	missense	probably damaging	1.00
R1184:Ptprt	UTSW	2	161927772	missense	possibly damaging	0.82
R1253:Ptprt	UTSW	2	162278226	missense	probably damaging	1.00
R1476:Ptprt	UTSW	2	161927484	missense	probably damaging	1.00
R1515:Ptprt	UTSW	2	162238034	missense	probably damaging	1.00
R1595:Ptprt	UTSW	2	161810549	critical splice donor site	probably null
R1939:Ptprt	UTSW	2	161927640	missense	probably benign	0.45
R1987:Ptprt	UTSW	2	161558898	missense	probably damaging	1.00
R1987:Ptprt	UTSW	2	161766321	missense	possibly damaging	0.48
R2049:Ptprt	UTSW	2	161534545	missense	probably damaging	1.00
R2140:Ptprt	UTSW	2	161811988	missense	probably damaging	1.00
R2421:Ptprt	UTSW	2	162278040	splice site	probably benign
R3432:Ptprt	UTSW	2	161927529	missense	probably damaging	1.00
R3619:Ptprt	UTSW	2	161566157	missense	probably damaging	1.00
R3757:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3758:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3834:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3835:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3915:Ptprt	UTSW	2	161555555	splice site	probably benign
R4003:Ptprt	UTSW	2	161566117	splice site	probably benign
R4387:Ptprt	UTSW	2	161927650	missense	probably damaging	1.00
R4519:Ptprt	UTSW	2	161564689	missense	probably damaging	1.00
R4618:Ptprt	UTSW	2	161553845	missense	probably damaging	1.00
R4677:Ptprt	UTSW	2	161901446	critical splice donor site	probably null
R4866:Ptprt	UTSW	2	161560239	missense	probably damaging	1.00
R5088:Ptprt	UTSW	2	162238175	missense	probably benign	0.01
R5173:Ptprt	UTSW	2	161927756	missense	probably benign	0.01
R5215:Ptprt	UTSW	2	162278164	missense	probably damaging	1.00
R5383:Ptprt	UTSW	2	161698049	missense	probably damaging	1.00
R5398:Ptprt	UTSW	2	161927592	missense	probably damaging	1.00
R5518:Ptprt	UTSW	2	162278223	missense	probably damaging	0.99
R5711:Ptprt	UTSW	2	161810604	missense	probably damaging	0.98
R5735:Ptprt	UTSW	2	161534564	missense	probably damaging	0.98
R5834:Ptprt	UTSW	2	161560269	missense	probably damaging	1.00
R5872:Ptprt	UTSW	2	162135218	missense	probably damaging	1.00
R5926:Ptprt	UTSW	2	161564686	missense	probably benign	0.00
R6210:Ptprt	UTSW	2	162268029	missense	probably damaging	1.00
R6285:Ptprt	UTSW	2	161901497	missense	possibly damaging	0.70
R6298:Ptprt	UTSW	2	161553859	missense	probably damaging	1.00
R6406:Ptprt	UTSW	2	161553783	missense	probably damaging	0.98
R6499:Ptprt	UTSW	2	161534587	missense	probably benign	0.32
R6613:Ptprt	UTSW	2	161530447	missense	probably damaging	1.00
R6622:Ptprt	UTSW	2	161553840	missense	probably damaging	1.00
R7218:Ptprt	UTSW	2	161547364	missense	probably damaging	1.00
R7247:Ptprt	UTSW	2	161533523	missense	probably benign	0.15
R7576:Ptprt	UTSW	2	161607305	missense	possibly damaging	0.88
R7733:Ptprt	UTSW	2	161575787	missense	probably damaging	1.00
R7735:Ptprt	UTSW	2	161575741	missense	probably damaging	1.00
R7813:Ptprt	UTSW	2	161530493	missense	probably damaging	1.00
R8031:Ptprt	UTSW	2	162135457	missense	probably damaging	1.00
R8074:Ptprt	UTSW	2	161927661	missense	possibly damaging	0.77
R8151:Ptprt	UTSW	2	162278085	missense	probably damaging	1.00
R8236:Ptprt	UTSW	2	161687068	critical splice donor site	probably null
R8308:Ptprt	UTSW	2	161927646	missense	probably benign	0.00
R8348:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8362:Ptprt	UTSW	2	161551747	missense	probably damaging	1.00
R8365:Ptprt	UTSW	2	161901531	missense	probably benign	0.05
R8448:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8512:Ptprt	UTSW	2	161558863	missense	probably benign	0.00
R8715:Ptprt	UTSW	2	161530543	missense	probably damaging	1.00
R9004:Ptprt	UTSW	2	161766394	missense	probably benign	0.04
R9046:Ptprt	UTSW	2	161530441	missense	possibly damaging	0.58
R9222:Ptprt	UTSW	2	161560186	missense	probably damaging	1.00
R9297:Ptprt	UTSW	2	161575778	missense	probably benign
R9318:Ptprt	UTSW	2	161575778	missense	probably benign
R9476:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9510:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9571:Ptprt	UTSW	2	161553812	missense	probably benign	0.10
X0064:Ptprt	UTSW	2	161927483	missense	probably damaging	1.00
Z1088:Ptprt	UTSW	2	162238121	missense	possibly damaging	0.86
Z1177:Ptprt	UTSW	2	161732887	missense	probably damaging	1.00
Z1177:Ptprt	UTSW	2	162362948	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CTTGTTGTTGCTCACGGTCAAAGG -3'
(R):5'- CCACCATTCAAATCTGGGCACAAGG -3'

Sequencing Primer
(F):5'- AAGGCAGGACTTCAGTTCTC -3'
(R):5'- ATACTTTTCTGACCAGTGGAGTGC -3'

Posted On

2013-05-09