Incidental Mutation 'R3702:Obox2'
ID341760
Institutional Source Beutler Lab
Gene Symbol Obox2
Ensembl Gene ENSMUSG00000074369
Gene Nameoocyte specific homeobox 2
Synonyms
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #R3702 (G1)
Quality Score48
Status Validated
Chromosome7
Chromosomal Location15388721-15398545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 15396957 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 38 (R38L)
Ref Sequence ENSEMBL: ENSMUSP00000134275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036575] [ENSMUST00000172478] [ENSMUST00000174076] [ENSMUST00000174305] [ENSMUST00000181001]
Predicted Effect probably benign
Transcript: ENSMUST00000036575
AA Change: R38L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000042995
Gene: ENSMUSG00000074369
AA Change: R38L

DomainStartEndE-ValueType
Blast:HOX 94 124 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172478
AA Change: R38L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133450
Gene: ENSMUSG00000074369
AA Change: R38L

DomainStartEndE-ValueType
Blast:HOX 94 124 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174076
AA Change: R38L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133793
Gene: ENSMUSG00000074369
AA Change: R38L

DomainStartEndE-ValueType
Blast:HOX 94 124 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174305
AA Change: R38L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134275
Gene: ENSMUSG00000074369
AA Change: R38L

DomainStartEndE-ValueType
Blast:HOX 94 124 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181001
SMART Domains Protein: ENSMUSP00000138010
Gene: ENSMUSG00000054310

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Obox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02798:Obox2 APN 7 15396882 missense possibly damaging 0.85
R1444:Obox2 UTSW 7 15397032 missense possibly damaging 0.95
R1620:Obox2 UTSW 7 15397041 missense probably benign 0.36
R1993:Obox2 UTSW 7 15397249 missense probably benign 0.00
R2394:Obox2 UTSW 7 15397010 missense possibly damaging 0.93
R2397:Obox2 UTSW 7 15397046 missense probably benign 0.02
R4926:Obox2 UTSW 7 15397177 splice site probably null
R6878:Obox2 UTSW 7 15397320 missense probably benign 0.02
R7373:Obox2 UTSW 7 15397220 nonsense probably null
R7483:Obox2 UTSW 7 15397316 missense probably damaging 0.97
Z1088:Obox2 UTSW 7 15397338 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACATGCTGAGTAGGTGGGATG -3'
(R):5'- ACTTGGATGCCCTGAGAATC -3'

Sequencing Primer
(F):5'- AAATGGGGGTTCTCTGGAGC -3'
(R):5'- AGAATCTTCTCAGAGTTGGTAAAAC -3'
Posted On2015-09-23