Incidental Mutation 'R4553:Epgn'
ID341773
Institutional Source Beutler Lab
Gene Symbol Epgn
Ensembl Gene ENSMUSG00000035020
Gene Nameepithelial mitogen
Synonyms2310069M11Rik, epigen
MMRRC Submission 041595-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4553 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location91027464-91035215 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 91027562 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 14 (K14*)
Ref Sequence ENSEMBL: ENSMUSP00000046987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041516] [ENSMUST00000202724]
Predicted Effect probably null
Transcript: ENSMUST00000041516
AA Change: K14*
SMART Domains Protein: ENSMUSP00000046987
Gene: ENSMUSG00000035020
AA Change: K14*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 58 95 1.01e-1 SMART
transmembrane domain 110 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202724
SMART Domains Protein: ENSMUSP00000144500
Gene: ENSMUSG00000035020

DomainStartEndE-ValueType
EGF 43 80 5.1e-4 SMART
transmembrane domain 95 117 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit moderate increase in absolute pancreas and spleen weight but normal epidermis and pilosebaceous unit development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,813,193 Y49C probably damaging Het
Adat1 T C 8: 111,990,280 T32A probably damaging Het
Adra2a T C 19: 54,046,735 V174A possibly damaging Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
Cand2 C A 6: 115,792,211 R661S probably damaging Het
Cd274 T C 19: 29,380,448 V180A probably benign Het
Crat T C 2: 30,408,217 T157A probably benign Het
Cts6 G A 13: 61,197,593 P230L probably damaging Het
Dppa2 A G 16: 48,310,514 Y3C possibly damaging Het
Fam71f2 A G 6: 29,287,706 I210M probably benign Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Hgfac T A 5: 35,042,856 C130S probably damaging Het
Ifi35 T C 11: 101,457,891 V188A probably damaging Het
Iqsec2 A G X: 152,211,281 H585R probably benign Het
Itih4 T C 14: 30,900,953 L842P probably damaging Het
Kif3a C A 11: 53,578,918 L119I possibly damaging Het
Lrp2 T C 2: 69,513,285 D910G probably benign Het
Lyve1 T C 7: 110,852,360 probably null Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Mx2 A G 16: 97,552,005 T398A possibly damaging Het
Nlrp4e T C 7: 23,320,979 M297T probably benign Het
Nog A G 11: 89,301,422 L200P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Phf11b G A 14: 59,341,285 P11S probably benign Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Pld1 G T 3: 28,124,702 R915L probably benign Het
Sell C T 1: 164,072,116 T34I probably benign Het
Slc34a1 G A 13: 55,412,061 probably null Het
Slc8b1 T C 5: 120,529,598 V432A probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Xab2 T C 8: 3,611,015 T700A probably benign Het
Other mutations in Epgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Epgn APN 5 91033957 missense probably damaging 0.99
R0309:Epgn UTSW 5 91032214 missense probably benign 0.06
R0478:Epgn UTSW 5 91031128 missense probably benign 0.00
R1034:Epgn UTSW 5 91032221 missense probably damaging 1.00
R4551:Epgn UTSW 5 91027562 nonsense probably null
R4552:Epgn UTSW 5 91027562 nonsense probably null
R4997:Epgn UTSW 5 91032239 missense possibly damaging 0.58
R5177:Epgn UTSW 5 91028277 start gained probably benign
R5754:Epgn UTSW 5 91033948 missense probably benign 0.09
R5881:Epgn UTSW 5 91028363 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTGGATTGGTAAGAACAGCCAG -3'
(R):5'- ACACTTCAGGCTTCTTTGAGAGAG -3'

Sequencing Primer
(F):5'- GAACAGCCAGATGACGCTTCG -3'
(R):5'- TCAGGCTTCTTTGAGAGAGAGAAAAG -3'
Posted On2015-09-24