Incidental Mutation 'R4553:Vmn1r117'
ID341780
Institutional Source Beutler Lab
Gene Symbol Vmn1r117
Ensembl Gene ENSMUSG00000096737
Gene Namevomeronasal 1 receptor 117
SynonymsGm8544
MMRRC Submission 041595-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4553 (G1)
Quality Score146
Status Not validated
Chromosome7
Chromosomal Location20883198-20884121 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20883592 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 177 (F177Y)
Ref Sequence ENSEMBL: ENSMUSP00000131580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166937]
Predicted Effect probably damaging
Transcript: ENSMUST00000166937
AA Change: F177Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131580
Gene: ENSMUSG00000096737
AA Change: F177Y

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 1.3e-15 PFAM
Pfam:7tm_1 31 290 3.9e-6 PFAM
Pfam:V1R 41 298 6.4e-17 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,813,193 Y49C probably damaging Het
Adat1 T C 8: 111,990,280 T32A probably damaging Het
Adra2a T C 19: 54,046,735 V174A possibly damaging Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
Cand2 C A 6: 115,792,211 R661S probably damaging Het
Cd274 T C 19: 29,380,448 V180A probably benign Het
Crat T C 2: 30,408,217 T157A probably benign Het
Cts6 G A 13: 61,197,593 P230L probably damaging Het
Dppa2 A G 16: 48,310,514 Y3C possibly damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Fam71f2 A G 6: 29,287,706 I210M probably benign Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Hgfac T A 5: 35,042,856 C130S probably damaging Het
Ifi35 T C 11: 101,457,891 V188A probably damaging Het
Iqsec2 A G X: 152,211,281 H585R probably benign Het
Itih4 T C 14: 30,900,953 L842P probably damaging Het
Kif3a C A 11: 53,578,918 L119I possibly damaging Het
Lrp2 T C 2: 69,513,285 D910G probably benign Het
Lyve1 T C 7: 110,852,360 probably null Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Mx2 A G 16: 97,552,005 T398A possibly damaging Het
Nlrp4e T C 7: 23,320,979 M297T probably benign Het
Nog A G 11: 89,301,422 L200P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Phf11b G A 14: 59,341,285 P11S probably benign Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Pld1 G T 3: 28,124,702 R915L probably benign Het
Sell C T 1: 164,072,116 T34I probably benign Het
Slc34a1 G A 13: 55,412,061 probably null Het
Slc8b1 T C 5: 120,529,598 V432A probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Xab2 T C 8: 3,611,015 T700A probably benign Het
Other mutations in Vmn1r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4519001:Vmn1r117 UTSW 7 20883235 missense possibly damaging 0.83
R0480:Vmn1r117 UTSW 7 20883446 missense probably benign 0.05
R1582:Vmn1r117 UTSW 7 20883559 missense possibly damaging 0.67
R3723:Vmn1r117 UTSW 7 20883455 missense probably damaging 1.00
R4552:Vmn1r117 UTSW 7 20883592 missense probably damaging 0.99
R4888:Vmn1r117 UTSW 7 20883496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGCATCAGGATAGTATGGG -3'
(R):5'- TGTGTCCTGAGTGTCCATCAG -3'

Sequencing Primer
(F):5'- CTTTGGACTGAGCTTGGCTTC -3'
(R):5'- TGAGTGTCCATCAGTTTGTCAC -3'
Posted On2015-09-24