Incidental Mutation 'R4553:Mtss1l'
ID341784
Institutional Source Beutler Lab
Gene Symbol Mtss1l
Ensembl Gene ENSMUSG00000033763
Gene Namemetastasis suppressor 1-like
SynonymsABBA
MMRRC Submission 041595-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4553 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110721476-110741400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110738505 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 464 (T464A)
Ref Sequence ENSEMBL: ENSMUSP00000115220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052457] [ENSMUST00000076846] [ENSMUST00000144041] [ENSMUST00000150680]
Predicted Effect probably damaging
Transcript: ENSMUST00000052457
AA Change: T526A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050211
Gene: ENSMUSG00000033763
AA Change: T526A

DomainStartEndE-ValueType
Pfam:IMD 15 236 8.1e-108 PFAM
low complexity region 252 274 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 312 330 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
low complexity region 668 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076846
SMART Domains Protein: ENSMUSP00000076120
Gene: ENSMUSG00000031750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:IL34 28 184 2e-79 PFAM
low complexity region 219 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133848
Predicted Effect probably benign
Transcript: ENSMUST00000141302
SMART Domains Protein: ENSMUSP00000116518
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 122 1e-56 PFAM
low complexity region 138 179 N/A INTRINSIC
low complexity region 202 213 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 286 304 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144041
AA Change: T464A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115220
Gene: ENSMUSG00000033763
AA Change: T464A

DomainStartEndE-ValueType
Pfam:IMD 1 174 3.6e-72 PFAM
low complexity region 190 212 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 306 324 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 606 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149273
SMART Domains Protein: ENSMUSP00000119495
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 126 2.5e-59 PFAM
low complexity region 142 183 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150680
SMART Domains Protein: ENSMUSP00000114398
Gene: ENSMUSG00000031750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:IL34 23 155 4.6e-64 PFAM
low complexity region 197 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154803
Meta Mutation Damage Score 0.1610 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,813,193 Y49C probably damaging Het
Adat1 T C 8: 111,990,280 T32A probably damaging Het
Adra2a T C 19: 54,046,735 V174A possibly damaging Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
Cand2 C A 6: 115,792,211 R661S probably damaging Het
Cd274 T C 19: 29,380,448 V180A probably benign Het
Crat T C 2: 30,408,217 T157A probably benign Het
Cts6 G A 13: 61,197,593 P230L probably damaging Het
Dppa2 A G 16: 48,310,514 Y3C possibly damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Fam71f2 A G 6: 29,287,706 I210M probably benign Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Hgfac T A 5: 35,042,856 C130S probably damaging Het
Ifi35 T C 11: 101,457,891 V188A probably damaging Het
Iqsec2 A G X: 152,211,281 H585R probably benign Het
Itih4 T C 14: 30,900,953 L842P probably damaging Het
Kif3a C A 11: 53,578,918 L119I possibly damaging Het
Lrp2 T C 2: 69,513,285 D910G probably benign Het
Lyve1 T C 7: 110,852,360 probably null Het
Mx2 A G 16: 97,552,005 T398A possibly damaging Het
Nlrp4e T C 7: 23,320,979 M297T probably benign Het
Nog A G 11: 89,301,422 L200P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Phf11b G A 14: 59,341,285 P11S probably benign Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Pld1 G T 3: 28,124,702 R915L probably benign Het
Sell C T 1: 164,072,116 T34I probably benign Het
Slc34a1 G A 13: 55,412,061 probably null Het
Slc8b1 T C 5: 120,529,598 V432A probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Xab2 T C 8: 3,611,015 T700A probably benign Het
Other mutations in Mtss1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02124:Mtss1l APN 8 110737624 missense probably damaging 1.00
R0620:Mtss1l UTSW 8 110737948 missense probably damaging 0.98
R0685:Mtss1l UTSW 8 110727397 critical splice donor site probably null
R2082:Mtss1l UTSW 8 110726257 critical splice donor site probably null
R2149:Mtss1l UTSW 8 110726383 missense possibly damaging 0.58
R2266:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2267:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2269:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2378:Mtss1l UTSW 8 110738349 missense probably damaging 1.00
R3756:Mtss1l UTSW 8 110730060 missense probably damaging 1.00
R4005:Mtss1l UTSW 8 110739041 frame shift probably null
R4552:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4849:Mtss1l UTSW 8 110726243 missense possibly damaging 0.92
R5212:Mtss1l UTSW 8 110729218 missense probably damaging 1.00
R6294:Mtss1l UTSW 8 110727328 missense possibly damaging 0.89
R6336:Mtss1l UTSW 8 110732164 missense probably damaging 1.00
R7090:Mtss1l UTSW 8 110730024 missense probably damaging 1.00
R7580:Mtss1l UTSW 8 110737636 missense possibly damaging 0.95
R7581:Mtss1l UTSW 8 110726213 missense possibly damaging 0.92
R7810:Mtss1l UTSW 8 110726201 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTACGACTGCTACTCTGTGAATG -3'
(R):5'- AAAGGTGAGGCCACTTCGTC -3'

Sequencing Primer
(F):5'- CTACTCTGTGAATGGGGATGCAGAC -3'
(R):5'- TCTGTGTAGAAGACGCACTC -3'
Posted On2015-09-24