Incidental Mutation 'R4554:Rfx8'
ID341799
Institutional Source Beutler Lab
Gene Symbol Rfx8
Ensembl Gene ENSMUSG00000057173
Gene Nameregulatory factor X 8
Synonyms4933400N17Rik
MMRRC Submission 041596-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4554 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location39665301-39720997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39680940 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 325 (R325H)
Ref Sequence ENSEMBL: ENSMUSP00000121212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151913]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126760
Predicted Effect probably benign
Transcript: ENSMUST00000151913
AA Change: R325H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121212
Gene: ENSMUSG00000057173
AA Change: R325H

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 17 94 6.5e-31 PFAM
Blast:DEXDc 301 358 4e-8 BLAST
low complexity region 445 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,156,343 A1772V possibly damaging Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Ahnak G A 19: 9,014,930 G4526D probably damaging Het
Alms1 G A 6: 85,624,617 R2150H probably benign Het
Amh A T 10: 80,807,051 E356D probably benign Het
Cap2 T A 13: 46,635,774 F152I probably damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Ep300 T A 15: 81,601,430 M206K unknown Het
Gm960 T C 19: 4,649,819 Q452R possibly damaging Het
Lsamp G C 16: 42,144,075 D271H probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mfsd11 T G 11: 116,861,580 V133G probably damaging Het
Ngrn C T 7: 80,264,701 T200I possibly damaging Het
Olfr1084 T A 2: 86,638,779 N310Y possibly damaging Het
Phf20l1 A G 15: 66,597,367 T117A probably damaging Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Poc5 A G 13: 96,403,021 K357E probably benign Het
Rhbdd3 C T 11: 5,105,946 P366L probably benign Het
Rtl1 T C 12: 109,594,328 N359S possibly damaging Het
Ryr1 T C 7: 29,105,008 T499A probably benign Het
Tex2 G T 11: 106,544,386 P738H unknown Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Zswim9 T C 7: 13,277,162 N87D probably benign Het
Other mutations in Rfx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Rfx8 APN 1 39682950 nonsense probably null
IGL01659:Rfx8 APN 1 39670573 missense probably damaging 1.00
IGL02239:Rfx8 APN 1 39680886 missense probably benign 0.00
IGL02302:Rfx8 APN 1 39665522 missense possibly damaging 0.50
IGL02332:Rfx8 APN 1 39718480 missense possibly damaging 0.89
IGL02598:Rfx8 APN 1 39695968 splice site probably benign
IGL02870:Rfx8 APN 1 39683711 missense possibly damaging 0.94
IGL03403:Rfx8 APN 1 39690173 missense possibly damaging 0.94
PIT4515001:Rfx8 UTSW 1 39690105 missense probably benign 0.04
R0060:Rfx8 UTSW 1 39718405 splice site probably benign
R0095:Rfx8 UTSW 1 39685536 missense possibly damaging 0.58
R0265:Rfx8 UTSW 1 39688577 missense possibly damaging 0.67
R1892:Rfx8 UTSW 1 39670586 splice site probably null
R2054:Rfx8 UTSW 1 39685559 missense possibly damaging 0.92
R2960:Rfx8 UTSW 1 39682952 missense probably damaging 1.00
R5410:Rfx8 UTSW 1 39710156 critical splice donor site probably null
R5496:Rfx8 UTSW 1 39670347 missense probably benign 0.01
R5502:Rfx8 UTSW 1 39682953 missense probably damaging 1.00
R5916:Rfx8 UTSW 1 39688619 missense probably benign 0.20
R6238:Rfx8 UTSW 1 39670394 missense probably damaging 0.96
R6360:Rfx8 UTSW 1 39680965 missense probably benign
R7593:Rfx8 UTSW 1 39683678 missense probably damaging 1.00
R7738:Rfx8 UTSW 1 39682931 missense probably damaging 1.00
T0722:Rfx8 UTSW 1 39683612 missense probably damaging 1.00
Z1088:Rfx8 UTSW 1 39682966 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTCTACAGGAAGACAAGTGTGAGC -3'
(R):5'- TTGAGATCGGATGTCAGTGCC -3'

Sequencing Primer
(F):5'- TGTGAGCACCTTCAACTAGG -3'
(R):5'- ATCGGATGTCAGTGCCCACAG -3'
Posted On2015-09-24