Incidental Mutation 'R4554:Thap12'
ID 341809
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene Name THAP domain containing 12
Synonyms Prkrir, Dap4, 2900052B10Rik
MMRRC Submission 041596-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock # R4554 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 98703103-98718062 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98715845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 407 (N407D)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
AlphaFold Q9CUX1
Predicted Effect probably benign
Transcript: ENSMUST00000033009
AA Change: N407D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: N407D

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146473
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208543
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,156,343 A1772V possibly damaging Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Ahnak G A 19: 9,014,930 G4526D probably damaging Het
Alms1 G A 6: 85,624,617 R2150H probably benign Het
Amh A T 10: 80,807,051 E356D probably benign Het
Cap2 T A 13: 46,635,774 F152I probably damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Ep300 T A 15: 81,601,430 M206K unknown Het
Gm960 T C 19: 4,649,819 Q452R possibly damaging Het
Lsamp G C 16: 42,144,075 D271H probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mfsd11 T G 11: 116,861,580 V133G probably damaging Het
Ngrn C T 7: 80,264,701 T200I possibly damaging Het
Olfr1084 T A 2: 86,638,779 N310Y possibly damaging Het
Phf20l1 A G 15: 66,597,367 T117A probably damaging Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Poc5 A G 13: 96,403,021 K357E probably benign Het
Rfx8 C T 1: 39,680,940 R325H probably benign Het
Rhbdd3 C T 11: 5,105,946 P366L probably benign Het
Rtl1 T C 12: 109,594,328 N359S possibly damaging Het
Ryr1 T C 7: 29,105,008 T499A probably benign Het
Tex2 G T 11: 106,544,386 P738H unknown Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Zswim9 T C 7: 13,277,162 N87D probably benign Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98716137 missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98712903 makesense probably null
IGL01973:Thap12 APN 7 98716499 missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98710133 missense probably damaging 1.00
H8562:Thap12 UTSW 7 98715107 missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98715038 missense probably benign 0.00
R0090:Thap12 UTSW 7 98715893 missense probably damaging 1.00
R0254:Thap12 UTSW 7 98715281 missense probably benign 0.03
R1344:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1384:Thap12 UTSW 7 98703438 missense probably damaging 0.98
R1418:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1448:Thap12 UTSW 7 98716023 missense probably benign 0.01
R1493:Thap12 UTSW 7 98715438 missense probably benign 0.30
R1906:Thap12 UTSW 7 98716740 missense probably damaging 1.00
R1932:Thap12 UTSW 7 98716838 missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98716365 missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98716620 missense probably damaging 1.00
R2092:Thap12 UTSW 7 98716449 missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98710126 missense probably damaging 0.97
R3850:Thap12 UTSW 7 98716663 missense probably damaging 1.00
R4086:Thap12 UTSW 7 98716494 missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98710078 intron probably benign
R4555:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4556:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4557:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4659:Thap12 UTSW 7 98710091 intron probably benign
R4734:Thap12 UTSW 7 98715954 missense probably damaging 0.98
R4734:Thap12 UTSW 7 98715955 nonsense probably null
R5794:Thap12 UTSW 7 98716393 missense probably benign 0.11
R5994:Thap12 UTSW 7 98716030 nonsense probably null
R6298:Thap12 UTSW 7 98703405 missense probably damaging 1.00
R6515:Thap12 UTSW 7 98707095 missense probably damaging 0.97
R6624:Thap12 UTSW 7 98715586 nonsense probably null
R6625:Thap12 UTSW 7 98716070 missense probably benign 0.00
R6965:Thap12 UTSW 7 98715462 missense probably damaging 1.00
R7560:Thap12 UTSW 7 98710231 missense probably damaging 0.99
R8713:Thap12 UTSW 7 98707076 missense probably benign 0.30
R8897:Thap12 UTSW 7 98715327 missense probably benign 0.38
R9099:Thap12 UTSW 7 98715393 missense probably damaging 1.00
R9260:Thap12 UTSW 7 98707073 nonsense probably null
R9339:Thap12 UTSW 7 98715116 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACATTGTGTCCAGTGGATTTTCTTC -3'
(R):5'- TGCACTACAGAGGACAAATGC -3'

Sequencing Primer
(F):5'- TTAGAAAAATATCCCCAGGCTGTC -3'
(R):5'- GAGGACAAATGCTCGCCCAG -3'
Posted On 2015-09-24