Mutagenetix > Incidental Mutation

Incidental Mutation 'R4554:Thap12'

341809

Institutional Source

Beutler Lab

Gene Symbol

Thap12

Ensembl Gene

ENSMUSG00000030753

Gene Name

THAP domain containing 12

Synonyms

Prkrir, Dap4, 2900052B10Rik

MMRRC Submission

041596-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R4554 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98703103-98718062 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98715845 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 407 (N407D)

Ref Sequence

ENSEMBL: ENSMUSP00000033009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]

AlphaFold

Q9CUX1

Predicted Effect

probably benign
Transcript: ENSMUST00000033009
AA Change: N407D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: N407D

Domain	Start	End	E-Value	Type
THAP	3	92	8.38e-22	SMART
DM3	21	91	1.49e-20	SMART
Pfam:DUF4371	112	338	1.9e-22	PFAM
low complexity region	433	445	N/A	INTRINSIC
Pfam:Dimer_Tnp_hAT	631	726	6.9e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126356

SMART Domains

Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

Domain	Start	End	E-Value	Type
THAP	3	78	3.21e-9	SMART
DM3	21	78	1.89e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146473

Predicted Effect

probably benign
Transcript: ENSMUST00000153566

SMART Domains

Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

Domain	Start	End	E-Value	Type
THAP	3	92	8.38e-22	SMART
DM3	21	91	1.49e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208543

Meta Mutation Damage Score

0.0576

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	T	3: 122,156,343	A1772V	possibly damaging	Het
Adamts17	A	T	7: 67,027,893	E518D	probably damaging	Het
Adgrb3	T	C	1: 25,084,279	R1414G	probably damaging	Het
Ahnak	G	A	19: 9,014,930	G4526D	probably damaging	Het
Alms1	G	A	6: 85,624,617	R2150H	probably benign	Het
Amh	A	T	10: 80,807,051	E356D	probably benign	Het
Cap2	T	A	13: 46,635,774	F152I	probably damaging	Het
Chil3	T	G	3: 106,160,370	K160Q	probably benign	Het
Ep300	T	A	15: 81,601,430	M206K	unknown	Het
Gm960	T	C	19: 4,649,819	Q452R	possibly damaging	Het
Lsamp	G	C	16: 42,144,075	D271H	probably damaging	Het
Marf1	T	C	16: 14,153,977		probably benign	Het
Mfsd11	T	G	11: 116,861,580	V133G	probably damaging	Het
Ngrn	C	T	7: 80,264,701	T200I	possibly damaging	Het
Olfr1084	T	A	2: 86,638,779	N310Y	possibly damaging	Het
Phf20l1	A	G	15: 66,597,367	T117A	probably damaging	Het
Pitpnm1	A	G	19: 4,103,085	Q135R	probably benign	Het
Poc5	A	G	13: 96,403,021	K357E	probably benign	Het
Rfx8	C	T	1: 39,680,940	R325H	probably benign	Het
Rhbdd3	C	T	11: 5,105,946	P366L	probably benign	Het
Rtl1	T	C	12: 109,594,328	N359S	possibly damaging	Het
Ryr1	T	C	7: 29,105,008	T499A	probably benign	Het
Tex2	G	T	11: 106,544,386	P738H	unknown	Het
Tmc5	T	C	7: 118,670,733	I902T	probably benign	Het
Zswim9	T	C	7: 13,277,162	N87D	probably benign	Het

Other mutations in Thap12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Thap12	APN	7	98716137	missense	possibly damaging	0.82
IGL01145:Thap12	APN	7	98712903	makesense	probably null
IGL01973:Thap12	APN	7	98716499	missense	possibly damaging	0.58
IGL02404:Thap12	APN	7	98710133	missense	probably damaging	1.00
H8562:Thap12	UTSW	7	98715107	missense	probably damaging	0.98
PIT4453001:Thap12	UTSW	7	98715038	missense	probably benign	0.00
R0090:Thap12	UTSW	7	98715893	missense	probably damaging	1.00
R0254:Thap12	UTSW	7	98715281	missense	probably benign	0.03
R1344:Thap12	UTSW	7	98716830	missense	probably damaging	0.97
R1384:Thap12	UTSW	7	98703438	missense	probably damaging	0.98
R1418:Thap12	UTSW	7	98716830	missense	probably damaging	0.97
R1448:Thap12	UTSW	7	98716023	missense	probably benign	0.01
R1493:Thap12	UTSW	7	98715438	missense	probably benign	0.30
R1906:Thap12	UTSW	7	98716740	missense	probably damaging	1.00
R1932:Thap12	UTSW	7	98716838	missense	possibly damaging	0.77
R1992:Thap12	UTSW	7	98716365	missense	possibly damaging	0.68
R2044:Thap12	UTSW	7	98716620	missense	probably damaging	1.00
R2092:Thap12	UTSW	7	98716449	missense	possibly damaging	0.70
R2160:Thap12	UTSW	7	98710126	missense	probably damaging	0.97
R3850:Thap12	UTSW	7	98716663	missense	probably damaging	1.00
R4086:Thap12	UTSW	7	98716494	missense	possibly damaging	0.94
R4162:Thap12	UTSW	7	98710078	intron	probably benign
R4555:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4556:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4557:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4659:Thap12	UTSW	7	98710091	intron	probably benign
R4734:Thap12	UTSW	7	98715954	missense	probably damaging	0.98
R4734:Thap12	UTSW	7	98715955	nonsense	probably null
R5794:Thap12	UTSW	7	98716393	missense	probably benign	0.11
R5994:Thap12	UTSW	7	98716030	nonsense	probably null
R6298:Thap12	UTSW	7	98703405	missense	probably damaging	1.00
R6515:Thap12	UTSW	7	98707095	missense	probably damaging	0.97
R6624:Thap12	UTSW	7	98715586	nonsense	probably null
R6625:Thap12	UTSW	7	98716070	missense	probably benign	0.00
R6965:Thap12	UTSW	7	98715462	missense	probably damaging	1.00
R7560:Thap12	UTSW	7	98710231	missense	probably damaging	0.99
R8182:Thap12	UTSW	7	98716377	missense	probably damaging	1.00
R8713:Thap12	UTSW	7	98707076	missense	probably benign	0.30
R8897:Thap12	UTSW	7	98715327	missense	probably benign	0.38
R9099:Thap12	UTSW	7	98715393	missense	probably damaging	1.00
R9260:Thap12	UTSW	7	98707073	nonsense	probably null
R9339:Thap12	UTSW	7	98715116	missense	possibly damaging	0.95
R9467:Thap12	UTSW	7	98710141	missense	probably damaging	0.99
R9644:Thap12	UTSW	7	98715288	missense	probably damaging	0.97
R9789:Thap12	UTSW	7	98703385	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ACATTGTGTCCAGTGGATTTTCTTC -3'
(R):5'- TGCACTACAGAGGACAAATGC -3'

Sequencing Primer
(F):5'- TTAGAAAAATATCCCCAGGCTGTC -3'
(R):5'- GAGGACAAATGCTCGCCCAG -3'

Posted On

2015-09-24