Incidental Mutation 'R4554:Rtl1'
ID341818
Institutional Source Beutler Lab
Gene Symbol Rtl1
Ensembl Gene ENSMUSG00000085925
Gene Nameretrotransposon Gaglike 1
SynonymsMart1, Mor1, Mar
MMRRC Submission 041596-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4554 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location109589193-109600330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109594328 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 359 (N359S)
Ref Sequence ENSEMBL: ENSMUSP00000115957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149046]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093625
Predicted Effect possibly damaging
Transcript: ENSMUST00000149046
AA Change: N359S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115957
Gene: ENSMUSG00000085925
AA Change: N359S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 41 80 N/A INTRINSIC
internal_repeat_1 88 163 8.8e-50 PROSPERO
internal_repeat_1 176 251 8.8e-50 PROSPERO
low complexity region 332 361 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 393 408 N/A INTRINSIC
Pfam:DUF4939 432 538 1.6e-14 PFAM
Pfam:Retrotrans_gag 493 586 9.2e-13 PFAM
low complexity region 611 632 N/A INTRINSIC
Pfam:gag-asp_proteas 663 731 2.3e-15 PFAM
low complexity region 833 849 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
PDB:4OL8|E 988 1192 6e-17 PDB
Blast:CYCc 989 1158 5e-9 BLAST
SCOP:d1sig__ 1291 1443 2e-4 SMART
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199494
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice heterozygous for a paternally inherited knock-out allele exhibit fetal/neonatal lethality associated with underdevelopment of the placenta. Mice heteroygous for a maternally inherited knock-out allele exhibit neonatal lethality and decreased survival associated with placental overdevelopment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,156,343 A1772V possibly damaging Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Ahnak G A 19: 9,014,930 G4526D probably damaging Het
Alms1 G A 6: 85,624,617 R2150H probably benign Het
Amh A T 10: 80,807,051 E356D probably benign Het
Cap2 T A 13: 46,635,774 F152I probably damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Ep300 T A 15: 81,601,430 M206K unknown Het
Gm960 T C 19: 4,649,819 Q452R possibly damaging Het
Lsamp G C 16: 42,144,075 D271H probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mfsd11 T G 11: 116,861,580 V133G probably damaging Het
Ngrn C T 7: 80,264,701 T200I possibly damaging Het
Olfr1084 T A 2: 86,638,779 N310Y possibly damaging Het
Phf20l1 A G 15: 66,597,367 T117A probably damaging Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Poc5 A G 13: 96,403,021 K357E probably benign Het
Rfx8 C T 1: 39,680,940 R325H probably benign Het
Rhbdd3 C T 11: 5,105,946 P366L probably benign Het
Ryr1 T C 7: 29,105,008 T499A probably benign Het
Tex2 G T 11: 106,544,386 P738H unknown Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Zswim9 T C 7: 13,277,162 N87D probably benign Het
Other mutations in Rtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rtl1 APN 12 109593000 missense probably benign 0.00
IGL01981:Rtl1 APN 12 109591935 missense possibly damaging 0.72
IGL02418:Rtl1 APN 12 109590449 missense probably damaging 1.00
IGL03164:Rtl1 APN 12 109592933 missense probably damaging 1.00
FR4304:Rtl1 UTSW 12 109591198 small deletion probably benign
R0109:Rtl1 UTSW 12 109595407 start gained probably benign
R0141:Rtl1 UTSW 12 109592948 missense probably damaging 1.00
R0312:Rtl1 UTSW 12 109590227 missense probably damaging 0.99
R0389:Rtl1 UTSW 12 109590363 missense possibly damaging 0.77
R0390:Rtl1 UTSW 12 109591386 missense unknown
R0548:Rtl1 UTSW 12 109591655 missense probably damaging 0.98
R0561:Rtl1 UTSW 12 109593929 missense probably damaging 0.99
R0624:Rtl1 UTSW 12 109592719 missense probably damaging 0.97
R0746:Rtl1 UTSW 12 109592960 missense probably damaging 1.00
R1353:Rtl1 UTSW 12 109592199 missense probably benign 0.00
R1868:Rtl1 UTSW 12 109590536 missense probably damaging 1.00
R1935:Rtl1 UTSW 12 109591920 missense probably benign 0.42
R2000:Rtl1 UTSW 12 109593887 missense probably damaging 1.00
R2094:Rtl1 UTSW 12 109591397 missense unknown
R2125:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R2166:Rtl1 UTSW 12 109590554 missense probably damaging 1.00
R2247:Rtl1 UTSW 12 109594979 missense possibly damaging 0.77
R2274:Rtl1 UTSW 12 109594667 missense unknown
R2919:Rtl1 UTSW 12 109591148 missense unknown
R2998:Rtl1 UTSW 12 109595096 missense probably damaging 0.99
R4566:Rtl1 UTSW 12 109592859 missense probably damaging 1.00
R4887:Rtl1 UTSW 12 109591704 missense probably damaging 0.96
R5399:Rtl1 UTSW 12 109590302 missense probably damaging 1.00
R5512:Rtl1 UTSW 12 109591371 missense unknown
R5616:Rtl1 UTSW 12 109592739 missense unknown
R5644:Rtl1 UTSW 12 109591579 missense probably benign 0.03
R5647:Rtl1 UTSW 12 109594679 missense unknown
R5695:Rtl1 UTSW 12 109594097 missense probably damaging 1.00
R5714:Rtl1 UTSW 12 109593680 missense probably damaging 0.99
R5786:Rtl1 UTSW 12 109592619 missense possibly damaging 0.89
R5917:Rtl1 UTSW 12 109591653 missense possibly damaging 0.82
R5948:Rtl1 UTSW 12 109590599 missense possibly damaging 0.86
R6051:Rtl1 UTSW 12 109593024 missense probably damaging 1.00
R6251:Rtl1 UTSW 12 109593649 missense probably benign 0.16
R6342:Rtl1 UTSW 12 109592301 missense possibly damaging 0.50
R6433:Rtl1 UTSW 12 109595196 missense unknown
R6815:Rtl1 UTSW 12 109594503 missense probably damaging 0.98
R6968:Rtl1 UTSW 12 109594679 missense unknown
R7002:Rtl1 UTSW 12 109593947 missense probably damaging 0.97
R7020:Rtl1 UTSW 12 109592315 missense possibly damaging 0.72
R7026:Rtl1 UTSW 12 109593161 missense probably damaging 0.99
R7027:Rtl1 UTSW 12 109591414 small deletion probably benign
R7196:Rtl1 UTSW 12 109592787 missense possibly damaging 0.83
R7239:Rtl1 UTSW 12 109592475 missense probably benign 0.05
R7312:Rtl1 UTSW 12 109595238 missense unknown
R7476:Rtl1 UTSW 12 109591105 missense unknown
R7589:Rtl1 UTSW 12 109593845 missense possibly damaging 0.91
R7655:Rtl1 UTSW 12 109591008 missense unknown
R7656:Rtl1 UTSW 12 109591008 missense unknown
R7657:Rtl1 UTSW 12 109595384 missense possibly damaging 0.94
R7720:Rtl1 UTSW 12 109594430 missense possibly damaging 0.96
R7772:Rtl1 UTSW 12 109593185 missense probably damaging 1.00
R7840:Rtl1 UTSW 12 109594155 missense probably benign 0.08
R7890:Rtl1 UTSW 12 109592817 missense possibly damaging 0.57
R7893:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R7894:Rtl1 UTSW 12 109594597 missense possibly damaging 0.70
R7909:Rtl1 UTSW 12 109590177 missense unknown
R7909:Rtl1 UTSW 12 109592480 missense possibly damaging 0.95
R7986:Rtl1 UTSW 12 109592058 missense possibly damaging 0.95
R8007:Rtl1 UTSW 12 109591626 missense possibly damaging 0.86
R8146:Rtl1 UTSW 12 109590711 missense probably benign 0.01
R8193:Rtl1 UTSW 12 109592216 missense probably benign 0.03
R8263:Rtl1 UTSW 12 109593746 missense probably damaging 0.99
R8273:Rtl1 UTSW 12 109592715 missense possibly damaging 0.92
R8512:Rtl1 UTSW 12 109594617 missense unknown
R8514:Rtl1 UTSW 12 109593873 missense possibly damaging 0.52
R8748:Rtl1 UTSW 12 109595058 missense probably benign 0.39
Z1088:Rtl1 UTSW 12 109592319 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAACAGCGAGATGACGTTC -3'
(R):5'- AAACCCAGAGTCGAGCGATG -3'

Sequencing Primer
(F):5'- AGATGACGTTCCCCATGGTG -3'
(R):5'- AGTCGAGCGATGTTTCCAAC -3'
Posted On2015-09-24