Incidental Mutation 'R4554:Cap2'
ID341819
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene NameCAP, adenylate cyclase-associated protein, 2 (yeast)
Synonyms
MMRRC Submission 041596-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4554 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location46501848-46650281 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46635774 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 152 (F152I)
Ref Sequence ENSEMBL: ENSMUSP00000112952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
Predicted Effect probably damaging
Transcript: ENSMUST00000021802
AA Change: F264I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: F264I

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119341
AA Change: F152I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373
AA Change: F152I

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225444
Predicted Effect probably damaging
Transcript: ENSMUST00000225824
AA Change: F209I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,156,343 A1772V possibly damaging Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Ahnak G A 19: 9,014,930 G4526D probably damaging Het
Alms1 G A 6: 85,624,617 R2150H probably benign Het
Amh A T 10: 80,807,051 E356D probably benign Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Ep300 T A 15: 81,601,430 M206K unknown Het
Gm960 T C 19: 4,649,819 Q452R possibly damaging Het
Lsamp G C 16: 42,144,075 D271H probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mfsd11 T G 11: 116,861,580 V133G probably damaging Het
Ngrn C T 7: 80,264,701 T200I possibly damaging Het
Olfr1084 T A 2: 86,638,779 N310Y possibly damaging Het
Phf20l1 A G 15: 66,597,367 T117A probably damaging Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Poc5 A G 13: 96,403,021 K357E probably benign Het
Rfx8 C T 1: 39,680,940 R325H probably benign Het
Rhbdd3 C T 11: 5,105,946 P366L probably benign Het
Rtl1 T C 12: 109,594,328 N359S possibly damaging Het
Ryr1 T C 7: 29,105,008 T499A probably benign Het
Tex2 G T 11: 106,544,386 P738H unknown Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Zswim9 T C 7: 13,277,162 N87D probably benign Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46639949 splice site probably benign
IGL01927:Cap2 APN 13 46635633 missense probably benign 0.03
IGL02213:Cap2 APN 13 46635611 splice site probably benign
IGL02511:Cap2 APN 13 46531022 start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46525492 missense probably benign 0.00
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0385:Cap2 UTSW 13 46560547 missense probably damaging 1.00
R0387:Cap2 UTSW 13 46560516 missense probably damaging 0.99
R0712:Cap2 UTSW 13 46615361 splice site probably null
R1489:Cap2 UTSW 13 46609635 missense probably damaging 1.00
R1666:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1668:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1676:Cap2 UTSW 13 46637859 missense probably damaging 1.00
R1756:Cap2 UTSW 13 46531013 missense probably benign 0.11
R1822:Cap2 UTSW 13 46615347 missense probably benign 0.03
R1867:Cap2 UTSW 13 46640079 missense probably damaging 1.00
R1972:Cap2 UTSW 13 46637899 missense probably damaging 0.98
R1990:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46560502 critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46639841 missense probably benign 0.20
R4024:Cap2 UTSW 13 46637841 splice site probably benign
R4748:Cap2 UTSW 13 46639826 missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46610110 missense probably damaging 0.99
R4876:Cap2 UTSW 13 46531021 start codon destroyed probably null
R4902:Cap2 UTSW 13 46531025 missense probably damaging 0.99
R5320:Cap2 UTSW 13 46648364 makesense probably null
R5666:Cap2 UTSW 13 46531083 splice site probably null
R5670:Cap2 UTSW 13 46531083 splice site probably null
R6086:Cap2 UTSW 13 46635712 missense probably damaging 1.00
R6728:Cap2 UTSW 13 46639859 missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46646625 missense probably damaging 1.00
R7785:Cap2 UTSW 13 46635748 missense probably benign
R7889:Cap2 UTSW 13 46646575 missense probably damaging 0.99
R8065:Cap2 UTSW 13 46637861 missense probably damaging 1.00
R8205:Cap2 UTSW 13 46615263 missense probably damaging 1.00
R8425:Cap2 UTSW 13 46609732 missense probably damaging 0.98
R8731:Cap2 UTSW 13 46646530 missense probably benign 0.00
R8738:Cap2 UTSW 13 46531072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAAAGCTCCCATCTTCTG -3'
(R):5'- GAAGCCTATGTTCCTGGAGCTG -3'

Sequencing Primer
(F):5'- TGTCTCCCACAGGGTCC -3'
(R):5'- CCTATGTTCCTGGAGCTGGAGAG -3'
Posted On2015-09-24