Incidental Mutation 'R4554:Poc5'
ID341820
Institutional Source Beutler Lab
Gene Symbol Poc5
Ensembl Gene ENSMUSG00000021671
Gene NamePOC5 centriolar protein
Synonyms
MMRRC Submission 041596-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4554 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location96388294-96417737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96403021 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 357 (K357E)
Ref Sequence ENSEMBL: ENSMUSP00000096898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099295]
Predicted Effect probably benign
Transcript: ENSMUST00000099295
AA Change: K357E

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096898
Gene: ENSMUSG00000021671
AA Change: K357E

DomainStartEndE-ValueType
coiled coil region 175 206 N/A INTRINSIC
coiled coil region 300 341 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223478
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,156,343 A1772V possibly damaging Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Ahnak G A 19: 9,014,930 G4526D probably damaging Het
Alms1 G A 6: 85,624,617 R2150H probably benign Het
Amh A T 10: 80,807,051 E356D probably benign Het
Cap2 T A 13: 46,635,774 F152I probably damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Ep300 T A 15: 81,601,430 M206K unknown Het
Gm960 T C 19: 4,649,819 Q452R possibly damaging Het
Lsamp G C 16: 42,144,075 D271H probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mfsd11 T G 11: 116,861,580 V133G probably damaging Het
Ngrn C T 7: 80,264,701 T200I possibly damaging Het
Olfr1084 T A 2: 86,638,779 N310Y possibly damaging Het
Phf20l1 A G 15: 66,597,367 T117A probably damaging Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Rfx8 C T 1: 39,680,940 R325H probably benign Het
Rhbdd3 C T 11: 5,105,946 P366L probably benign Het
Rtl1 T C 12: 109,594,328 N359S possibly damaging Het
Ryr1 T C 7: 29,105,008 T499A probably benign Het
Tex2 G T 11: 106,544,386 P738H unknown Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Zswim9 T C 7: 13,277,162 N87D probably benign Het
Other mutations in Poc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Poc5 APN 13 96410746 missense probably damaging 1.00
IGL01377:Poc5 APN 13 96401631 missense probably benign 0.35
IGL02981:Poc5 APN 13 96401757 critical splice donor site probably null
IGL03031:Poc5 APN 13 96401615 missense probably benign 0.00
R0348:Poc5 UTSW 13 96398866 missense probably null 1.00
R1533:Poc5 UTSW 13 96391644 missense probably damaging 0.96
R1881:Poc5 UTSW 13 96398731 missense probably benign 0.21
R2171:Poc5 UTSW 13 96410749 missense probably damaging 1.00
R2337:Poc5 UTSW 13 96410603 missense probably damaging 0.98
R3419:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R3736:Poc5 UTSW 13 96396816 missense probably damaging 1.00
R5223:Poc5 UTSW 13 96402955 missense probably benign 0.20
R5436:Poc5 UTSW 13 96396813 missense probably damaging 1.00
R6089:Poc5 UTSW 13 96396671 missense probably damaging 1.00
R6700:Poc5 UTSW 13 96394495 missense probably benign 0.00
R7345:Poc5 UTSW 13 96396796 missense probably damaging 1.00
R7354:Poc5 UTSW 13 96394525 missense probably benign 0.02
R7363:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R7454:Poc5 UTSW 13 96400832 missense possibly damaging 0.93
R7773:Poc5 UTSW 13 96410635 missense probably damaging 1.00
R7786:Poc5 UTSW 13 96404519 missense possibly damaging 0.55
R7953:Poc5 UTSW 13 96402900 missense probably benign 0.27
X0019:Poc5 UTSW 13 96394548 frame shift probably null
X0024:Poc5 UTSW 13 96394548 frame shift probably null
X0034:Poc5 UTSW 13 96394548 frame shift probably null
X0035:Poc5 UTSW 13 96394548 frame shift probably null
X0036:Poc5 UTSW 13 96394548 frame shift probably null
X0037:Poc5 UTSW 13 96394548 frame shift probably null
X0038:Poc5 UTSW 13 96394548 frame shift probably null
X0039:Poc5 UTSW 13 96394548 frame shift probably null
X0040:Poc5 UTSW 13 96394548 frame shift probably null
X0052:Poc5 UTSW 13 96394548 frame shift probably null
X0053:Poc5 UTSW 13 96394548 frame shift probably null
X0054:Poc5 UTSW 13 96394548 frame shift probably null
X0058:Poc5 UTSW 13 96394548 frame shift probably null
X0060:Poc5 UTSW 13 96394548 frame shift probably null
X0061:Poc5 UTSW 13 96394548 frame shift probably null
X0062:Poc5 UTSW 13 96394548 frame shift probably null
X0063:Poc5 UTSW 13 96394548 frame shift probably null
Z1176:Poc5 UTSW 13 96401722 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGTTTCAATCCCCACAACGC -3'
(R):5'- AGTGTCGAGAGCTACCATCAGC -3'

Sequencing Primer
(F):5'- TCCCCACAACGCACACATG -3'
(R):5'- CAACGAGTAGGGTAACTCTTACTTCG -3'
Posted On2015-09-24