Incidental Mutation 'R4555:Pip4k2a'
ID341829
Institutional Source Beutler Lab
Gene Symbol Pip4k2a
Ensembl Gene ENSMUSG00000026737
Gene Namephosphatidylinositol-5-phosphate 4-kinase, type II, alpha
SynonymsPip5k2a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4555 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location18842255-18998126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18872292 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 211 (D211N)
Ref Sequence ENSEMBL: ENSMUSP00000006912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006912]
Predicted Effect probably damaging
Transcript: ENSMUST00000006912
AA Change: D211N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006912
Gene: ENSMUSG00000026737
AA Change: D211N

DomainStartEndE-ValueType
PIPKc 62 405 1.19e-169 SMART
Predicted Effect unknown
Transcript: ENSMUST00000152981
AA Change: D113N
SMART Domains Protein: ENSMUSP00000119075
Gene: ENSMUSG00000026737
AA Change: D113N

DomainStartEndE-ValueType
Pfam:PIP5K 18 198 1.4e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol-5,4-bisphosphate, the precursor to second messengers of the phosphoinositide signal transduction pathways, is thought to be involved in the regulation of secretion, cell proliferation, differentiation, and motility. The protein encoded by this gene is one of a family of enzymes capable of catalyzing the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. The amino acid sequence of this enzyme does not show homology to other kinases, but the recombinant protein does exhibit kinase activity. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Afp T G 5: 90,506,687 I528S possibly damaging Het
Cul9 T C 17: 46,501,829 D2407G possibly damaging Het
Cyp19a1 T C 9: 54,166,821 E483G probably damaging Het
Dennd2c G A 3: 103,131,886 V117I probably benign Het
Inha C T 1: 75,509,583 P174L possibly damaging Het
Myo15 A G 11: 60,496,937 R746G probably damaging Het
Ndufaf7 T C 17: 78,942,087 S138P probably benign Het
Osmr T C 15: 6,815,720 Q855R possibly damaging Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Plxna1 G T 6: 89,323,328 T1591K probably damaging Het
Rdh19 T A 10: 127,850,151 L44Q probably benign Het
Rom1 T C 19: 8,928,016 T267A possibly damaging Het
Smad3 C T 9: 63,654,788 V108I possibly damaging Het
Sptb A C 12: 76,612,851 S1092A probably benign Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ugt1a6a C T 1: 88,138,627 R52* probably null Het
Usp54 C T 14: 20,561,022 R1242H probably benign Het
Vps16 T C 2: 130,443,576 V813A probably damaging Het
Other mutations in Pip4k2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Pip4k2a APN 2 18872336 missense probably benign 0.10
IGL01682:Pip4k2a APN 2 18997968 missense probably benign
IGL02379:Pip4k2a APN 2 18866111 critical splice donor site probably null
R0096:Pip4k2a UTSW 2 18889039 splice site probably benign
R0184:Pip4k2a UTSW 2 18889128 missense probably damaging 0.96
R0514:Pip4k2a UTSW 2 18845936 missense probably damaging 0.99
R1673:Pip4k2a UTSW 2 18872282 critical splice donor site probably null
R1779:Pip4k2a UTSW 2 18847622 missense probably benign 0.27
R2198:Pip4k2a UTSW 2 18847655 missense probably damaging 0.98
R5408:Pip4k2a UTSW 2 18906308 missense probably benign 0.03
R7598:Pip4k2a UTSW 2 18872287 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATGGCATGTGGTACTACATGG -3'
(R):5'- GATACACCACGTTTTGACAGCTAC -3'

Sequencing Primer
(F):5'- ACTACATGGCATGTGGCTGAC -3'
(R):5'- ACACCACGTTTTGACAGCTACTTTTC -3'
Posted On2015-09-24