Incidental Mutation 'R4555:Vps16'
ID341830
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene NameVSP16 CORVET/HOPS core subunit
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R4555 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130424339-130444269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130443576 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 813 (V813A)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
Predicted Effect probably damaging
Transcript: ENSMUST00000028900
AA Change: V813A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: V813A

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Afp T G 5: 90,506,687 I528S possibly damaging Het
Cul9 T C 17: 46,501,829 D2407G possibly damaging Het
Cyp19a1 T C 9: 54,166,821 E483G probably damaging Het
Dennd2c G A 3: 103,131,886 V117I probably benign Het
Inha C T 1: 75,509,583 P174L possibly damaging Het
Myo15 A G 11: 60,496,937 R746G probably damaging Het
Ndufaf7 T C 17: 78,942,087 S138P probably benign Het
Osmr T C 15: 6,815,720 Q855R possibly damaging Het
Pip4k2a C T 2: 18,872,292 D211N probably damaging Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Plxna1 G T 6: 89,323,328 T1591K probably damaging Het
Rdh19 T A 10: 127,850,151 L44Q probably benign Het
Rom1 T C 19: 8,928,016 T267A possibly damaging Het
Smad3 C T 9: 63,654,788 V108I possibly damaging Het
Sptb A C 12: 76,612,851 S1092A probably benign Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ugt1a6a C T 1: 88,138,627 R52* probably null Het
Usp54 C T 14: 20,561,022 R1242H probably benign Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCAAGGCTTTGCTTCTTG -3'
(R):5'- CAGTTTTGCCTCAAAGCCTG -3'

Sequencing Primer
(F):5'- GTTGGGTAAGTTAGATGAAGGCCTC -3'
(R):5'- CTTTTCTTAAGCCAGACAGCATAC -3'
Posted On2015-09-24