Incidental Mutation 'R4555:A830005F24Rik'
ID341846
Institutional Source Beutler Lab
Gene Symbol A830005F24Rik
Ensembl Gene ENSMUSG00000053181
Gene NameRIKEN cDNA A830005F24 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4555 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location48513570-48514859 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 48514461 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065465] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
Predicted Effect unknown
Transcript: ENSMUST00000065465
AA Change: F80L
Predicted Effect probably benign
Transcript: ENSMUST00000176176
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176949
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176996
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177474
Predicted Effect probably benign
Transcript: ENSMUST00000177530
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Afp T G 5: 90,506,687 I528S possibly damaging Het
Cul9 T C 17: 46,501,829 D2407G possibly damaging Het
Cyp19a1 T C 9: 54,166,821 E483G probably damaging Het
Dennd2c G A 3: 103,131,886 V117I probably benign Het
Inha C T 1: 75,509,583 P174L possibly damaging Het
Myo15 A G 11: 60,496,937 R746G probably damaging Het
Ndufaf7 T C 17: 78,942,087 S138P probably benign Het
Osmr T C 15: 6,815,720 Q855R possibly damaging Het
Pip4k2a C T 2: 18,872,292 D211N probably damaging Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Plxna1 G T 6: 89,323,328 T1591K probably damaging Het
Rdh19 T A 10: 127,850,151 L44Q probably benign Het
Rom1 T C 19: 8,928,016 T267A possibly damaging Het
Smad3 C T 9: 63,654,788 V108I possibly damaging Het
Sptb A C 12: 76,612,851 S1092A probably benign Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ugt1a6a C T 1: 88,138,627 R52* probably null Het
Usp54 C T 14: 20,561,022 R1242H probably benign Het
Vps16 T C 2: 130,443,576 V813A probably damaging Het
Other mutations in A830005F24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:A830005F24Rik UTSW 13 48514372 unclassified probably benign
R4556:A830005F24Rik UTSW 13 48514461 unclassified probably benign
R4557:A830005F24Rik UTSW 13 48514461 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACGAAGTGAGCAGCGAACTC -3'
(R):5'- TTCCTAGGTGAAACAAGAAAGGCTC -3'

Sequencing Primer
(F):5'- GAACTCCCCTGGTGAGAAAC -3'
(R):5'- CTTGTCTTCCTATCAAGATGAAACC -3'
Posted On2015-09-24