Incidental Mutation 'R0316:Pkd2'
ID34185
Institutional Source Beutler Lab
Gene Symbol Pkd2
Ensembl Gene ENSMUSG00000034462
Gene Namepolycystic kidney disease 2
SynonymsC030034P18Rik, TRPP2, polycystin-2, PC2
MMRRC Submission 038526-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0316 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104459450-104505819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104477166 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 276 (D276G)
Ref Sequence ENSEMBL: ENSMUSP00000084041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086831]
Predicted Effect probably damaging
Transcript: ENSMUST00000086831
AA Change: D276G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084041
Gene: ENSMUSG00000034462
AA Change: D276G

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
Pfam:PKD_channel 265 685 1.3e-171 PFAM
Pfam:Ion_trans 454 690 2.6e-25 PFAM
coiled coil region 765 794 N/A INTRINSIC
PDB:3HRN|A 834 893 8e-31 PDB
low complexity region 900 915 N/A INTRINSIC
low complexity region 949 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130931
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in cardiac septation, kidney and pancreatic cysts, impaired left-right axis determination, and late-gestation lethality. Heterozygotes show kidney and liver lesions and have reduced longevity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,369 F276I probably damaging Het
Ado A G 10: 67,548,718 L19P possibly damaging Het
Ago2 T C 15: 73,130,876 H169R probably damaging Het
Asic1 G A 15: 99,671,938 A47T probably benign Het
Atg16l2 A T 7: 101,293,396 I364N probably damaging Het
C130050O18Rik G A 5: 139,414,558 R122Q probably damaging Het
Capn7 T A 14: 31,347,809 C197S probably benign Het
Casp16-ps T C 17: 23,552,092 D113G probably damaging Het
Cdh18 T A 15: 23,366,913 V235D probably damaging Het
Clca4a G T 3: 144,953,764 T777K probably damaging Het
Col17a1 A G 19: 47,685,533 probably null Het
Col5a3 C A 9: 20,775,325 D1335Y unknown Het
Cpxm1 T C 2: 130,393,171 E576G probably damaging Het
Dcbld2 T C 16: 58,433,445 S182P probably damaging Het
Dclk1 C T 3: 55,502,892 S616L probably damaging Het
Dgcr14 G A 16: 17,910,094 P103S probably benign Het
Dll4 C A 2: 119,331,153 D405E probably damaging Het
Dnah1 G A 14: 31,278,151 R2462C probably benign Het
Dnah3 A T 7: 119,965,659 Y2594N possibly damaging Het
Fam110a C A 2: 151,970,086 A255S probably benign Het
Fbn2 G A 18: 58,113,325 R502W probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Gm1527 T C 3: 28,915,774 S342P probably damaging Het
Gm19668 A T 10: 77,798,730 probably benign Het
Gm5901 A T 7: 105,377,315 T97S probably damaging Het
Greb1l A G 18: 10,547,420 Y1546C probably damaging Het
Impg1 A T 9: 80,342,065 S619T probably damaging Het
Itih2 C A 2: 10,105,246 Q565H possibly damaging Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lama3 T C 18: 12,519,877 M218T probably benign Het
Lipg T C 18: 74,960,941 S12G probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mex3d G T 10: 80,381,671 P571T probably damaging Het
Neb A C 2: 52,195,470 Y1538D possibly damaging Het
Nsd1 T C 13: 55,213,771 I184T probably damaging Het
Olfr1143 T C 2: 87,803,181 F264S probably damaging Het
Olfr1451 T A 19: 12,999,402 C139S probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pacs1 T C 19: 5,135,121 silent Het
Pdcd11 T C 19: 47,113,172 V932A probably damaging Het
Pkia T A 3: 7,437,439 D25E probably damaging Het
Plxna2 A C 1: 194,644,150 S131R probably damaging Het
Prelid1 T C 13: 55,324,407 V132A possibly damaging Het
Psma3 T C 12: 70,983,389 Y59H probably benign Het
Ptchd3 A C 11: 121,842,090 E602A possibly damaging Het
Ptpro T C 6: 137,376,989 V121A possibly damaging Het
Ptprt A G 2: 161,607,319 L878P probably damaging Het
Pxn G A 5: 115,553,968 G370S probably damaging Het
Rcn2 G T 9: 56,042,169 A40S probably benign Het
Rnf215 A G 11: 4,139,760 N258D probably damaging Het
Rnpc3 T C 3: 113,629,973 T28A probably damaging Het
Rtel1 T A 2: 181,356,002 V1100E possibly damaging Het
Scn3a T A 2: 65,460,829 I1858F probably damaging Het
Slc9c1 G A 16: 45,580,232 R735Q possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata13 A G 14: 60,692,339 T449A probably benign Het
Svep1 A G 4: 58,072,737 W2191R probably damaging Het
Thbs1 G A 2: 118,117,574 R405H probably damaging Het
Tnn A G 1: 160,120,567 Y859H possibly damaging Het
Tonsl A G 15: 76,629,300 S1245P possibly damaging Het
Tpcn1 G A 5: 120,539,259 T661M probably damaging Het
Trap1 A G 16: 4,045,560 F533L probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Vax2 T C 6: 83,711,444 S50P possibly damaging Het
Vmn1r5 A C 6: 56,985,799 E153A probably benign Het
Vmn2r14 G T 5: 109,218,896 P486Q probably benign Het
Vmn2r96 T A 17: 18,582,565 F246I probably damaging Het
Zc3h10 C A 10: 128,544,755 E244D probably damaging Het
Zdhhc18 T A 4: 133,613,655 K265* probably null Het
Other mutations in Pkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pkd2 APN 5 104483135 missense probably damaging 1.00
IGL01527:Pkd2 APN 5 104498884 splice site probably benign
IGL01805:Pkd2 APN 5 104483093 missense probably benign 0.41
IGL02146:Pkd2 APN 5 104489291 missense probably damaging 1.00
IGL02326:Pkd2 APN 5 104477075 missense probably benign 0.38
IGL02481:Pkd2 APN 5 104486770 missense probably damaging 1.00
IGL02952:Pkd2 APN 5 104480160 missense possibly damaging 0.48
IGL03026:Pkd2 APN 5 104494887 splice site probably benign
IGL03409:Pkd2 APN 5 104489349 nonsense probably null
Nephro UTSW 5 104486806 missense probably damaging 1.00
reggae UTSW 5 104477179 splice site probably null
samba UTSW 5 104477123 missense probably benign 0.01
IGL02988:Pkd2 UTSW 5 104503605 nonsense probably null
PIT1430001:Pkd2 UTSW 5 104459788 missense probably damaging 0.99
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0045:Pkd2 UTSW 5 104455805 unclassified probably benign
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0315:Pkd2 UTSW 5 104459850 missense possibly damaging 0.94
R0570:Pkd2 UTSW 5 104455605 unclassified probably benign
R1277:Pkd2 UTSW 5 104502359 missense probably damaging 0.97
R1883:Pkd2 UTSW 5 104483228 missense probably damaging 1.00
R1907:Pkd2 UTSW 5 104486806 missense probably damaging 1.00
R1937:Pkd2 UTSW 5 104478924 missense probably damaging 1.00
R2023:Pkd2 UTSW 5 104466878 splice site probably null
R2080:Pkd2 UTSW 5 104477123 missense probably benign 0.01
R2081:Pkd2 UTSW 5 104460211 missense probably benign 0.00
R2098:Pkd2 UTSW 5 104478902 missense probably damaging 1.00
R2117:Pkd2 UTSW 5 104483176 missense probably damaging 1.00
R2146:Pkd2 UTSW 5 104455590 unclassified probably benign
R2163:Pkd2 UTSW 5 104455677 unclassified probably benign
R3401:Pkd2 UTSW 5 104480327 missense possibly damaging 0.68
R3732:Pkd2 UTSW 5 104489419 splice site probably null
R3733:Pkd2 UTSW 5 104489419 splice site probably null
R4409:Pkd2 UTSW 5 104466884 splice site silent
R4582:Pkd2 UTSW 5 104502344 nonsense probably null
R5189:Pkd2 UTSW 5 104459919 missense probably benign 0.22
R5191:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5195:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5198:Pkd2 UTSW 5 104483092 missense probably benign 0.06
R5326:Pkd2 UTSW 5 104486649 splice site silent
R5406:Pkd2 UTSW 5 104480332 missense probably damaging 1.00
R5542:Pkd2 UTSW 5 104486649 splice site silent
R5543:Pkd2 UTSW 5 104489333 missense probably damaging 1.00
R5633:Pkd2 UTSW 5 104498506 missense probably damaging 0.98
R5887:Pkd2 UTSW 5 104498539 missense probably damaging 1.00
R5906:Pkd2 UTSW 5 104477179 splice site probably null
R5924:Pkd2 UTSW 5 104498558 missense probably damaging 0.99
R6361:Pkd2 UTSW 5 104486680 nonsense probably null
R6455:Pkd2 UTSW 5 104459924 missense probably benign 0.00
R6495:Pkd2 UTSW 5 104489293 missense probably damaging 1.00
R6735:Pkd2 UTSW 5 104480329 missense probably damaging 1.00
R6837:Pkd2 UTSW 5 104477043 missense probably damaging 1.00
R7192:Pkd2 UTSW 5 104486657 missense probably benign 0.00
R7477:Pkd2 UTSW 5 104483242 missense probably benign 0.19
R7560:Pkd2 UTSW 5 104480353 missense probably damaging 1.00
R7867:Pkd2 UTSW 5 104483120 missense probably damaging 1.00
R7894:Pkd2 UTSW 5 104480237 missense probably damaging 1.00
R8251:Pkd2 UTSW 5 104498487 missense probably benign 0.01
Z1088:Pkd2 UTSW 5 104498861 missense probably damaging 1.00
Z1176:Pkd2 UTSW 5 104460049 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACAATGTCTGCCTACCAGGAAGGG -3'
(R):5'- GCGGAAAGCACTTTCAGCGTTCTC -3'

Sequencing Primer
(F):5'- TCGTGGAGGCTGTGAGC -3'
(R):5'- GCGTTCTCCATGAATACTGAAGG -3'
Posted On2013-05-09