Incidental Mutation 'R4556:Sh3tc1'
ID341864
Institutional Source Beutler Lab
Gene Symbol Sh3tc1
Ensembl Gene ENSMUSG00000036553
Gene NameSH3 domain and tetratricopeptide repeats 1
Synonyms
MMRRC Submission 041597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4556 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location35697180-35739987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35707082 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 587 (Y587C)
Ref Sequence ENSEMBL: ENSMUSP00000144175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070203] [ENSMUST00000129664] [ENSMUST00000201511]
Predicted Effect probably damaging
Transcript: ENSMUST00000070203
AA Change: Y587C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070610
Gene: ENSMUSG00000036553
AA Change: Y587C

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127288
Predicted Effect unknown
Transcript: ENSMUST00000127825
AA Change: Y525C
SMART Domains Protein: ENSMUSP00000115376
Gene: ENSMUSG00000036553
AA Change: Y525C

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
SH3 251 310 1.72e-6 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
low complexity region 480 491 N/A INTRINSIC
TPR 504 537 3.41e1 SMART
Blast:TPR 546 578 2e-6 BLAST
TPR 607 640 3.37e-2 SMART
TPR 735 768 6.4e1 SMART
Blast:TPR 813 841 2e-6 BLAST
TPR 852 885 9.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129664
SMART Domains Protein: ENSMUSP00000119811
Gene: ENSMUSG00000036553

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
SH3 76 130 2.41e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151555
Predicted Effect probably damaging
Transcript: ENSMUST00000201511
AA Change: Y587C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144175
Gene: ENSMUSG00000036553
AA Change: Y587C

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Ccdc109b G A 3: 129,915,735 Q310* probably null Het
Cdk5rap2 A G 4: 70,239,312 S1601P probably damaging Het
Erc2 A C 14: 28,302,904 D580A probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Fbxo42 T A 4: 141,199,010 H334Q probably damaging Het
Gdf5 A G 2: 155,941,862 R24G probably benign Het
Lama3 G T 18: 12,479,759 R1200L possibly damaging Het
Lxn T A 3: 67,458,620 I182F possibly damaging Het
Mbd5 G A 2: 49,279,394 G1526R probably damaging Het
Ndufaf7 T C 17: 78,942,087 S138P probably benign Het
Nktr A G 9: 121,741,123 T90A probably damaging Het
Nr1h5 G A 3: 102,946,141 A350V probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr868 T C 9: 20,101,323 L188P possibly damaging Het
Pros1 A G 16: 62,900,673 K197R possibly damaging Het
Rmnd5b G T 11: 51,626,905 probably null Het
Rnf25 A T 1: 74,599,105 I26N probably damaging Het
Scn4a T C 11: 106,320,446 I1582V probably benign Het
Sh2d3c A G 2: 32,753,009 T583A possibly damaging Het
Slc6a11 A G 6: 114,244,812 S488G probably benign Het
Smim22 T A 16: 5,007,866 F38L possibly damaging Het
Stab2 T G 10: 86,967,679 E335D possibly damaging Het
Tas2r102 T C 6: 132,762,915 F262S probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmem225 T C 9: 40,149,466 F107S probably damaging Het
Vmn1r229 T A 17: 20,814,691 V66E possibly damaging Het
Vmn1r27 A G 6: 58,215,819 S67P possibly damaging Het
Xrcc4 A T 13: 89,992,504 H195Q probably benign Het
Other mutations in Sh3tc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Sh3tc1 APN 5 35710957 missense probably damaging 1.00
IGL01019:Sh3tc1 APN 5 35703375 missense probably damaging 1.00
IGL01725:Sh3tc1 APN 5 35700316 missense probably benign 0.08
IGL02069:Sh3tc1 APN 5 35718995 missense probably benign 0.45
IGL02153:Sh3tc1 APN 5 35703352 missense probably damaging 1.00
IGL02269:Sh3tc1 APN 5 35706284 missense probably benign 0.21
IGL02609:Sh3tc1 APN 5 35707172 missense probably damaging 0.99
IGL02984:Sh3tc1 UTSW 5 35714059 splice site probably null
R0280:Sh3tc1 UTSW 5 35706017 missense probably damaging 1.00
R0305:Sh3tc1 UTSW 5 35723999 missense probably benign
R0322:Sh3tc1 UTSW 5 35706561 missense possibly damaging 0.86
R0485:Sh3tc1 UTSW 5 35702012 splice site probably benign
R0511:Sh3tc1 UTSW 5 35703462 missense probably damaging 1.00
R0513:Sh3tc1 UTSW 5 35700307 missense possibly damaging 0.87
R0523:Sh3tc1 UTSW 5 35724066 small deletion probably benign
R0550:Sh3tc1 UTSW 5 35699784 missense probably damaging 0.99
R0676:Sh3tc1 UTSW 5 35719114 splice site probably benign
R1485:Sh3tc1 UTSW 5 35719026 missense probably benign 0.00
R1559:Sh3tc1 UTSW 5 35703349 critical splice donor site probably null
R1599:Sh3tc1 UTSW 5 35707512 missense probably benign 0.05
R1759:Sh3tc1 UTSW 5 35705904 missense possibly damaging 0.95
R1808:Sh3tc1 UTSW 5 35705924 missense probably benign 0.01
R1816:Sh3tc1 UTSW 5 35700584 critical splice donor site probably null
R2036:Sh3tc1 UTSW 5 35716164 missense probably benign 0.01
R2092:Sh3tc1 UTSW 5 35700658 missense probably damaging 1.00
R2944:Sh3tc1 UTSW 5 35714160 missense probably damaging 1.00
R4258:Sh3tc1 UTSW 5 35706978 missense probably benign 0.00
R4647:Sh3tc1 UTSW 5 35706318 missense probably damaging 1.00
R5011:Sh3tc1 UTSW 5 35700289 missense probably damaging 1.00
R5740:Sh3tc1 UTSW 5 35707055 missense probably benign 0.00
R6023:Sh3tc1 UTSW 5 35706951 nonsense probably null
R6164:Sh3tc1 UTSW 5 35706246 missense probably benign 0.05
R6262:Sh3tc1 UTSW 5 35699773 missense probably damaging 1.00
R6433:Sh3tc1 UTSW 5 35706597 missense probably damaging 0.99
R6932:Sh3tc1 UTSW 5 35707434 missense probably benign 0.01
R6986:Sh3tc1 UTSW 5 35723944 missense probably benign
R7098:Sh3tc1 UTSW 5 35702014 splice site probably null
R7502:Sh3tc1 UTSW 5 35706062 missense probably damaging 0.96
R7737:Sh3tc1 UTSW 5 35723953 missense probably benign 0.15
R7792:Sh3tc1 UTSW 5 35710951 missense probably damaging 0.97
X0061:Sh3tc1 UTSW 5 35706809 missense probably damaging 1.00
Z1176:Sh3tc1 UTSW 5 35714229 missense not run
Predicted Primers PCR Primer
(F):5'- ATACTTCAGCAGCTCCGCATC -3'
(R):5'- TTCCGGAGCCTGTACGATATCTC -3'

Sequencing Primer
(F):5'- ATCTGCGTTGCAGGAGT -3'
(R):5'- GGAGCCTGTACGATATCTCACTTC -3'
Posted On2015-09-24