Incidental Mutation 'R4556:Thap12'
ID 341870
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene Name THAP domain containing 12
Synonyms Prkrir, Dap4, 2900052B10Rik
MMRRC Submission 041597-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock # R4556 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 98703103-98718062 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98715845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 407 (N407D)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
AlphaFold Q9CUX1
Predicted Effect probably benign
Transcript: ENSMUST00000033009
AA Change: N407D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: N407D

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146473
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208543
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Ccdc109b G A 3: 129,915,735 Q310* probably null Het
Cdk5rap2 A G 4: 70,239,312 S1601P probably damaging Het
Erc2 A C 14: 28,302,904 D580A probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Fbxo42 T A 4: 141,199,010 H334Q probably damaging Het
Gdf5 A G 2: 155,941,862 R24G probably benign Het
Lama3 G T 18: 12,479,759 R1200L possibly damaging Het
Lxn T A 3: 67,458,620 I182F possibly damaging Het
Mbd5 G A 2: 49,279,394 G1526R probably damaging Het
Ndufaf7 T C 17: 78,942,087 S138P probably benign Het
Nktr A G 9: 121,741,123 T90A probably damaging Het
Nr1h5 G A 3: 102,946,141 A350V probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr868 T C 9: 20,101,323 L188P possibly damaging Het
Pros1 A G 16: 62,900,673 K197R possibly damaging Het
Rmnd5b G T 11: 51,626,905 probably null Het
Rnf25 A T 1: 74,599,105 I26N probably damaging Het
Scn4a T C 11: 106,320,446 I1582V probably benign Het
Sh2d3c A G 2: 32,753,009 T583A possibly damaging Het
Sh3tc1 T C 5: 35,707,082 Y587C probably damaging Het
Slc6a11 A G 6: 114,244,812 S488G probably benign Het
Smim22 T A 16: 5,007,866 F38L possibly damaging Het
Stab2 T G 10: 86,967,679 E335D possibly damaging Het
Tas2r102 T C 6: 132,762,915 F262S probably damaging Het
Tmem225 T C 9: 40,149,466 F107S probably damaging Het
Vmn1r229 T A 17: 20,814,691 V66E possibly damaging Het
Vmn1r27 A G 6: 58,215,819 S67P possibly damaging Het
Xrcc4 A T 13: 89,992,504 H195Q probably benign Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98716137 missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98712903 makesense probably null
IGL01973:Thap12 APN 7 98716499 missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98710133 missense probably damaging 1.00
H8562:Thap12 UTSW 7 98715107 missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98715038 missense probably benign 0.00
R0090:Thap12 UTSW 7 98715893 missense probably damaging 1.00
R0254:Thap12 UTSW 7 98715281 missense probably benign 0.03
R1344:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1384:Thap12 UTSW 7 98703438 missense probably damaging 0.98
R1418:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1448:Thap12 UTSW 7 98716023 missense probably benign 0.01
R1493:Thap12 UTSW 7 98715438 missense probably benign 0.30
R1906:Thap12 UTSW 7 98716740 missense probably damaging 1.00
R1932:Thap12 UTSW 7 98716838 missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98716365 missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98716620 missense probably damaging 1.00
R2092:Thap12 UTSW 7 98716449 missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98710126 missense probably damaging 0.97
R3850:Thap12 UTSW 7 98716663 missense probably damaging 1.00
R4086:Thap12 UTSW 7 98716494 missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98710078 intron probably benign
R4554:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4555:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4557:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4659:Thap12 UTSW 7 98710091 intron probably benign
R4734:Thap12 UTSW 7 98715954 missense probably damaging 0.98
R4734:Thap12 UTSW 7 98715955 nonsense probably null
R5794:Thap12 UTSW 7 98716393 missense probably benign 0.11
R5994:Thap12 UTSW 7 98716030 nonsense probably null
R6298:Thap12 UTSW 7 98703405 missense probably damaging 1.00
R6515:Thap12 UTSW 7 98707095 missense probably damaging 0.97
R6624:Thap12 UTSW 7 98715586 nonsense probably null
R6625:Thap12 UTSW 7 98716070 missense probably benign 0.00
R6965:Thap12 UTSW 7 98715462 missense probably damaging 1.00
R7560:Thap12 UTSW 7 98710231 missense probably damaging 0.99
R8713:Thap12 UTSW 7 98707076 missense probably benign 0.30
R8897:Thap12 UTSW 7 98715327 missense probably benign 0.38
R9099:Thap12 UTSW 7 98715393 missense probably damaging 1.00
R9260:Thap12 UTSW 7 98707073 nonsense probably null
R9339:Thap12 UTSW 7 98715116 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGCTTACATTGTGTCCAGTGG -3'
(R):5'- GCTCGCCCAGCTATATAGTTATTCC -3'

Sequencing Primer
(F):5'- TTAGAAAAATATCCCCAGGCTGTC -3'
(R):5'- AGTTATTCCACCTAACATTTGTGTC -3'
Posted On 2015-09-24