Mutagenetix > Incidental Mutation

Incidental Mutation 'R4556:Thap12'

341870

Institutional Source

Beutler Lab

Gene Symbol

Thap12

Ensembl Gene

ENSMUSG00000030753

Gene Name

THAP domain containing 12

Synonyms

Prkrir, Dap4, 2900052B10Rik

MMRRC Submission

041597-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R4556 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98703103-98718062 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98715845 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 407 (N407D)

Ref Sequence

ENSEMBL: ENSMUSP00000033009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]

AlphaFold

Q9CUX1

Predicted Effect

probably benign
Transcript: ENSMUST00000033009
AA Change: N407D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: N407D

Domain	Start	End	E-Value	Type
THAP	3	92	8.38e-22	SMART
DM3	21	91	1.49e-20	SMART
Pfam:DUF4371	112	338	1.9e-22	PFAM
low complexity region	433	445	N/A	INTRINSIC
Pfam:Dimer_Tnp_hAT	631	726	6.9e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126356

SMART Domains

Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

Domain	Start	End	E-Value	Type
THAP	3	78	3.21e-9	SMART
DM3	21	78	1.89e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146473

Predicted Effect

probably benign
Transcript: ENSMUST00000153566

SMART Domains

Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

Domain	Start	End	E-Value	Type
THAP	3	92	8.38e-22	SMART
DM3	21	91	1.49e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208543

Meta Mutation Damage Score

0.0576

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830005F24Rik	T	C	13: 48,514,461		probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Adamts17	A	T	7: 67,027,893	E518D	probably damaging	Het
Cdk5rap2	A	G	4: 70,239,312	S1601P	probably damaging	Het
Erc2	A	C	14: 28,302,904	D580A	probably damaging	Het
Fbxo4	A	G	15: 3,965,705	*386R	probably null	Het
Fbxo42	T	A	4: 141,199,010	H334Q	probably damaging	Het
Gdf5	A	G	2: 155,941,862	R24G	probably benign	Het
Lama3	G	T	18: 12,479,759	R1200L	possibly damaging	Het
Lxn	T	A	3: 67,458,620	I182F	possibly damaging	Het
Mbd5	G	A	2: 49,279,394	G1526R	probably damaging	Het
Mcub	G	A	3: 129,915,735	Q310*	probably null	Het
Ndufaf7	T	C	17: 78,942,087	S138P	probably benign	Het
Nktr	A	G	9: 121,741,123	T90A	probably damaging	Het
Nr1h5	G	A	3: 102,946,141	A350V	probably benign	Het
Olfr389	G	A	11: 73,776,481	T282I	possibly damaging	Het
Olfr868	T	C	9: 20,101,323	L188P	possibly damaging	Het
Pros1	A	G	16: 62,900,673	K197R	possibly damaging	Het
Rmnd5b	G	T	11: 51,626,905		probably null	Het
Rnf25	A	T	1: 74,599,105	I26N	probably damaging	Het
Scn4a	T	C	11: 106,320,446	I1582V	probably benign	Het
Sh2d3c	A	G	2: 32,753,009	T583A	possibly damaging	Het
Sh3tc1	T	C	5: 35,707,082	Y587C	probably damaging	Het
Slc6a11	A	G	6: 114,244,812	S488G	probably benign	Het
Smim22	T	A	16: 5,007,866	F38L	possibly damaging	Het
Stab2	T	G	10: 86,967,679	E335D	possibly damaging	Het
Tas2r102	T	C	6: 132,762,915	F262S	probably damaging	Het
Tmem225	T	C	9: 40,149,466	F107S	probably damaging	Het
Vmn1r229	T	A	17: 20,814,691	V66E	possibly damaging	Het
Vmn1r27	A	G	6: 58,215,819	S67P	possibly damaging	Het
Xrcc4	A	T	13: 89,992,504	H195Q	probably benign	Het

Other mutations in Thap12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Thap12	APN	7	98716137	missense	possibly damaging	0.82
IGL01145:Thap12	APN	7	98712903	makesense	probably null
IGL01973:Thap12	APN	7	98716499	missense	possibly damaging	0.58
IGL02404:Thap12	APN	7	98710133	missense	probably damaging	1.00
H8562:Thap12	UTSW	7	98715107	missense	probably damaging	0.98
PIT4453001:Thap12	UTSW	7	98715038	missense	probably benign	0.00
R0090:Thap12	UTSW	7	98715893	missense	probably damaging	1.00
R0254:Thap12	UTSW	7	98715281	missense	probably benign	0.03
R1344:Thap12	UTSW	7	98716830	missense	probably damaging	0.97
R1384:Thap12	UTSW	7	98703438	missense	probably damaging	0.98
R1418:Thap12	UTSW	7	98716830	missense	probably damaging	0.97
R1448:Thap12	UTSW	7	98716023	missense	probably benign	0.01
R1493:Thap12	UTSW	7	98715438	missense	probably benign	0.30
R1906:Thap12	UTSW	7	98716740	missense	probably damaging	1.00
R1932:Thap12	UTSW	7	98716838	missense	possibly damaging	0.77
R1992:Thap12	UTSW	7	98716365	missense	possibly damaging	0.68
R2044:Thap12	UTSW	7	98716620	missense	probably damaging	1.00
R2092:Thap12	UTSW	7	98716449	missense	possibly damaging	0.70
R2160:Thap12	UTSW	7	98710126	missense	probably damaging	0.97
R3850:Thap12	UTSW	7	98716663	missense	probably damaging	1.00
R4086:Thap12	UTSW	7	98716494	missense	possibly damaging	0.94
R4162:Thap12	UTSW	7	98710078	intron	probably benign
R4554:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4555:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4557:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4659:Thap12	UTSW	7	98710091	intron	probably benign
R4734:Thap12	UTSW	7	98715954	missense	probably damaging	0.98
R4734:Thap12	UTSW	7	98715955	nonsense	probably null
R5794:Thap12	UTSW	7	98716393	missense	probably benign	0.11
R5994:Thap12	UTSW	7	98716030	nonsense	probably null
R6298:Thap12	UTSW	7	98703405	missense	probably damaging	1.00
R6515:Thap12	UTSW	7	98707095	missense	probably damaging	0.97
R6624:Thap12	UTSW	7	98715586	nonsense	probably null
R6625:Thap12	UTSW	7	98716070	missense	probably benign	0.00
R6965:Thap12	UTSW	7	98715462	missense	probably damaging	1.00
R7560:Thap12	UTSW	7	98710231	missense	probably damaging	0.99
R8182:Thap12	UTSW	7	98716377	missense	probably damaging	1.00
R8713:Thap12	UTSW	7	98707076	missense	probably benign	0.30
R8897:Thap12	UTSW	7	98715327	missense	probably benign	0.38
R9099:Thap12	UTSW	7	98715393	missense	probably damaging	1.00
R9260:Thap12	UTSW	7	98707073	nonsense	probably null
R9339:Thap12	UTSW	7	98715116	missense	possibly damaging	0.95
R9467:Thap12	UTSW	7	98710141	missense	probably damaging	0.99
R9644:Thap12	UTSW	7	98715288	missense	probably damaging	0.97
R9789:Thap12	UTSW	7	98703385	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGCTTACATTGTGTCCAGTGG -3'
(R):5'- GCTCGCCCAGCTATATAGTTATTCC -3'

Sequencing Primer
(F):5'- TTAGAAAAATATCCCCAGGCTGTC -3'
(R):5'- AGTTATTCCACCTAACATTTGTGTC -3'

Posted On

2015-09-24