Incidental Mutation 'R4556:Xrcc4'
ID 341880
Institutional Source Beutler Lab
Gene Symbol Xrcc4
Ensembl Gene ENSMUSG00000021615
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 4
Synonyms 2310057B22Rik
MMRRC Submission 041597-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.392) question?
Stock # R4556 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 89997033-90237727 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90140623 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 195 (H195Q)
Ref Sequence ENSEMBL: ENSMUSP00000123934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022115] [ENSMUST00000159199]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022115
AA Change: H195Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022115
Gene: ENSMUSG00000021615
AA Change: H195Q

DomainStartEndE-ValueType
Pfam:XRCC4 1 326 1.5e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159199
AA Change: H195Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123934
Gene: ENSMUSG00000021615
AA Change: H195Q

DomainStartEndE-ValueType
Pfam:XRCC4 1 310 2.7e-151 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternative splicing generates several transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants have massive neuronal apoptosis, growth retardation, hypoplastic thymus and die by embryonic day 17.5. Lethality is rescued by Trp53 deficiency, but double knockout mice die from pro-B-cell lymphomas with Myc-Igh translocations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,667,937 (GRCm39) probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adamts17 A T 7: 66,677,641 (GRCm39) E518D probably damaging Het
Cdk5rap2 A G 4: 70,157,549 (GRCm39) S1601P probably damaging Het
Erc2 A C 14: 28,024,861 (GRCm39) D580A probably damaging Het
Fbxo4 A G 15: 3,995,187 (GRCm39) *386R probably null Het
Fbxo42 T A 4: 140,926,321 (GRCm39) H334Q probably damaging Het
Gdf5 A G 2: 155,783,782 (GRCm39) R24G probably benign Het
Lama3 G T 18: 12,612,816 (GRCm39) R1200L possibly damaging Het
Lxn T A 3: 67,365,953 (GRCm39) I182F possibly damaging Het
Mbd5 G A 2: 49,169,406 (GRCm39) G1526R probably damaging Het
Mcub G A 3: 129,709,384 (GRCm39) Q310* probably null Het
Ndufaf7 T C 17: 79,249,516 (GRCm39) S138P probably benign Het
Nktr A G 9: 121,570,189 (GRCm39) T90A probably damaging Het
Nr1h5 G A 3: 102,853,457 (GRCm39) A350V probably benign Het
Or1e29 G A 11: 73,667,307 (GRCm39) T282I possibly damaging Het
Or7e174 T C 9: 20,012,619 (GRCm39) L188P possibly damaging Het
Pros1 A G 16: 62,721,036 (GRCm39) K197R possibly damaging Het
Rmnd5b G T 11: 51,517,732 (GRCm39) probably null Het
Rnf25 A T 1: 74,638,264 (GRCm39) I26N probably damaging Het
Scn4a T C 11: 106,211,272 (GRCm39) I1582V probably benign Het
Sh2d3c A G 2: 32,643,021 (GRCm39) T583A possibly damaging Het
Sh3tc1 T C 5: 35,864,426 (GRCm39) Y587C probably damaging Het
Slc6a11 A G 6: 114,221,773 (GRCm39) S488G probably benign Het
Smim22 T A 16: 4,825,730 (GRCm39) F38L possibly damaging Het
Stab2 T G 10: 86,803,543 (GRCm39) E335D possibly damaging Het
Tas2r102 T C 6: 132,739,878 (GRCm39) F262S probably damaging Het
Thap12 A G 7: 98,365,052 (GRCm39) N407D probably benign Het
Tmem225 T C 9: 40,060,762 (GRCm39) F107S probably damaging Het
Vmn1r229 T A 17: 21,034,953 (GRCm39) V66E possibly damaging Het
Vmn1r27 A G 6: 58,192,804 (GRCm39) S67P possibly damaging Het
Other mutations in Xrcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Xrcc4 APN 13 90,210,169 (GRCm39) missense probably benign 0.00
IGL01486:Xrcc4 APN 13 90,210,151 (GRCm39) nonsense probably null
R0624:Xrcc4 UTSW 13 90,140,594 (GRCm39) missense possibly damaging 0.81
R0629:Xrcc4 UTSW 13 90,149,024 (GRCm39) splice site probably benign
R1801:Xrcc4 UTSW 13 90,140,698 (GRCm39) missense probably damaging 1.00
R2567:Xrcc4 UTSW 13 90,210,261 (GRCm39) missense probably damaging 0.99
R3055:Xrcc4 UTSW 13 90,210,196 (GRCm39) missense probably benign 0.06
R3056:Xrcc4 UTSW 13 90,210,196 (GRCm39) missense probably benign 0.06
R3941:Xrcc4 UTSW 13 90,219,752 (GRCm39) missense probably benign 0.01
R4486:Xrcc4 UTSW 13 90,140,707 (GRCm39) missense possibly damaging 0.79
R4599:Xrcc4 UTSW 13 90,210,126 (GRCm39) critical splice donor site probably null
R6057:Xrcc4 UTSW 13 90,139,198 (GRCm39) missense possibly damaging 0.95
R6262:Xrcc4 UTSW 13 89,926,906 (GRCm39) missense probably benign 0.00
R6597:Xrcc4 UTSW 13 90,149,048 (GRCm39) missense probably benign 0.24
R9080:Xrcc4 UTSW 13 90,149,097 (GRCm39) missense probably damaging 0.99
R9535:Xrcc4 UTSW 13 90,089,118 (GRCm39) missense probably benign 0.00
Z1176:Xrcc4 UTSW 13 90,089,161 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGAATGGCTAAACGACTACC -3'
(R):5'- TCCCTTGAGCATTATAACATTCCAGG -3'

Sequencing Primer
(F):5'- AGGCATTCTACTGAGAGC -3'
(R):5'- TGAGAAATGTGTGAGTGC -3'
Posted On 2015-09-24