Incidental Mutation 'R4556:Erc2'
ID 341881
Institutional Source Beutler Lab
Gene Symbol Erc2
Ensembl Gene ENSMUSG00000040640
Gene Name ELKS/RAB6-interacting/CAST family member 2
Synonyms D14Ertd171e, ELKS2alpha, CAST
MMRRC Submission 041597-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4556 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 27344385-28200494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 28024861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 580 (D580A)
Ref Sequence ENSEMBL: ENSMUSP00000147744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210924] [ENSMUST00000211145]
AlphaFold Q6PH08
Predicted Effect probably damaging
Transcript: ENSMUST00000090302
AA Change: D910A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: D910A

DomainStartEndE-ValueType
low complexity region 14 45 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
Pfam:Cast 150 907 N/A PFAM
low complexity region 916 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209800
Predicted Effect probably damaging
Transcript: ENSMUST00000210135
AA Change: D934A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000210924
AA Change: D580A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211145
AA Change: D914A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,667,937 (GRCm39) probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adamts17 A T 7: 66,677,641 (GRCm39) E518D probably damaging Het
Cdk5rap2 A G 4: 70,157,549 (GRCm39) S1601P probably damaging Het
Fbxo4 A G 15: 3,995,187 (GRCm39) *386R probably null Het
Fbxo42 T A 4: 140,926,321 (GRCm39) H334Q probably damaging Het
Gdf5 A G 2: 155,783,782 (GRCm39) R24G probably benign Het
Lama3 G T 18: 12,612,816 (GRCm39) R1200L possibly damaging Het
Lxn T A 3: 67,365,953 (GRCm39) I182F possibly damaging Het
Mbd5 G A 2: 49,169,406 (GRCm39) G1526R probably damaging Het
Mcub G A 3: 129,709,384 (GRCm39) Q310* probably null Het
Ndufaf7 T C 17: 79,249,516 (GRCm39) S138P probably benign Het
Nktr A G 9: 121,570,189 (GRCm39) T90A probably damaging Het
Nr1h5 G A 3: 102,853,457 (GRCm39) A350V probably benign Het
Or1e29 G A 11: 73,667,307 (GRCm39) T282I possibly damaging Het
Or7e174 T C 9: 20,012,619 (GRCm39) L188P possibly damaging Het
Pros1 A G 16: 62,721,036 (GRCm39) K197R possibly damaging Het
Rmnd5b G T 11: 51,517,732 (GRCm39) probably null Het
Rnf25 A T 1: 74,638,264 (GRCm39) I26N probably damaging Het
Scn4a T C 11: 106,211,272 (GRCm39) I1582V probably benign Het
Sh2d3c A G 2: 32,643,021 (GRCm39) T583A possibly damaging Het
Sh3tc1 T C 5: 35,864,426 (GRCm39) Y587C probably damaging Het
Slc6a11 A G 6: 114,221,773 (GRCm39) S488G probably benign Het
Smim22 T A 16: 4,825,730 (GRCm39) F38L possibly damaging Het
Stab2 T G 10: 86,803,543 (GRCm39) E335D possibly damaging Het
Tas2r102 T C 6: 132,739,878 (GRCm39) F262S probably damaging Het
Thap12 A G 7: 98,365,052 (GRCm39) N407D probably benign Het
Tmem225 T C 9: 40,060,762 (GRCm39) F107S probably damaging Het
Vmn1r229 T A 17: 21,034,953 (GRCm39) V66E possibly damaging Het
Vmn1r27 A G 6: 58,192,804 (GRCm39) S67P possibly damaging Het
Xrcc4 A T 13: 90,140,623 (GRCm39) H195Q probably benign Het
Other mutations in Erc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Erc2 APN 14 27,762,478 (GRCm39) missense probably damaging 0.98
IGL01862:Erc2 APN 14 27,993,526 (GRCm39) splice site probably benign
IGL01906:Erc2 APN 14 27,863,263 (GRCm39) missense probably damaging 0.99
IGL02177:Erc2 APN 14 27,620,580 (GRCm39) missense probably benign 0.00
IGL02481:Erc2 APN 14 27,375,028 (GRCm39) missense probably damaging 1.00
IGL02483:Erc2 APN 14 27,375,028 (GRCm39) missense probably damaging 1.00
IGL02623:Erc2 APN 14 27,498,937 (GRCm39) missense probably damaging 1.00
IGL03252:Erc2 APN 14 28,197,606 (GRCm39) utr 3 prime probably benign
IGL03378:Erc2 APN 14 27,733,680 (GRCm39) missense probably damaging 1.00
lobe UTSW 14 28,039,208 (GRCm39) missense probably damaging 0.96
R0091:Erc2 UTSW 14 27,498,781 (GRCm39) critical splice acceptor site probably null
R0309:Erc2 UTSW 14 27,863,182 (GRCm39) missense probably damaging 0.98
R0357:Erc2 UTSW 14 27,498,979 (GRCm39) missense probably damaging 0.99
R0378:Erc2 UTSW 14 27,733,651 (GRCm39) missense probably damaging 1.00
R0550:Erc2 UTSW 14 27,993,608 (GRCm39) missense possibly damaging 0.74
R0815:Erc2 UTSW 14 27,747,105 (GRCm39) missense probably benign 0.04
R0863:Erc2 UTSW 14 27,747,105 (GRCm39) missense probably benign 0.04
R1121:Erc2 UTSW 14 28,197,612 (GRCm39) utr 3 prime probably benign
R1164:Erc2 UTSW 14 28,024,929 (GRCm39) missense probably damaging 0.99
R1498:Erc2 UTSW 14 28,024,855 (GRCm39) missense probably benign 0.27
R1500:Erc2 UTSW 14 27,993,617 (GRCm39) missense probably damaging 0.98
R1555:Erc2 UTSW 14 27,733,622 (GRCm39) missense probably damaging 0.99
R1894:Erc2 UTSW 14 27,863,185 (GRCm39) missense probably damaging 0.99
R1950:Erc2 UTSW 14 27,634,857 (GRCm39) missense probably damaging 0.99
R1991:Erc2 UTSW 14 27,733,593 (GRCm39) missense probably benign 0.34
R2698:Erc2 UTSW 14 27,993,662 (GRCm39) missense probably benign 0.06
R2847:Erc2 UTSW 14 27,762,445 (GRCm39) missense probably damaging 0.97
R3015:Erc2 UTSW 14 27,733,732 (GRCm39) critical splice donor site probably null
R3612:Erc2 UTSW 14 27,499,134 (GRCm39) missense possibly damaging 0.69
R3759:Erc2 UTSW 14 27,747,120 (GRCm39) missense possibly damaging 0.94
R3857:Erc2 UTSW 14 28,197,599 (GRCm39) utr 3 prime probably benign
R3858:Erc2 UTSW 14 28,197,599 (GRCm39) utr 3 prime probably benign
R3859:Erc2 UTSW 14 28,197,599 (GRCm39) utr 3 prime probably benign
R4739:Erc2 UTSW 14 27,498,838 (GRCm39) missense probably damaging 1.00
R4898:Erc2 UTSW 14 27,375,285 (GRCm39) missense probably damaging 1.00
R5068:Erc2 UTSW 14 28,024,900 (GRCm39) missense possibly damaging 0.63
R5113:Erc2 UTSW 14 27,374,829 (GRCm39) missense probably benign 0.40
R5418:Erc2 UTSW 14 27,688,467 (GRCm39) missense probably benign 0.14
R5741:Erc2 UTSW 14 28,024,826 (GRCm39) splice site probably null
R5819:Erc2 UTSW 14 27,863,326 (GRCm39) missense probably damaging 0.97
R5930:Erc2 UTSW 14 27,498,815 (GRCm39) missense probably damaging 0.99
R6073:Erc2 UTSW 14 27,733,593 (GRCm39) missense probably benign 0.00
R6150:Erc2 UTSW 14 27,863,248 (GRCm39) missense probably damaging 0.97
R6182:Erc2 UTSW 14 28,039,210 (GRCm39) missense probably damaging 0.99
R6188:Erc2 UTSW 14 28,039,208 (GRCm39) missense probably damaging 0.96
R6267:Erc2 UTSW 14 27,802,112 (GRCm39) missense probably damaging 1.00
R6296:Erc2 UTSW 14 27,802,112 (GRCm39) missense probably damaging 1.00
R6730:Erc2 UTSW 14 27,620,524 (GRCm39) missense possibly damaging 0.95
R6969:Erc2 UTSW 14 27,620,553 (GRCm39) missense probably damaging 1.00
R7095:Erc2 UTSW 14 27,620,550 (GRCm39) missense probably damaging 0.99
R7221:Erc2 UTSW 14 27,375,115 (GRCm39) missense probably damaging 0.97
R7365:Erc2 UTSW 14 27,762,346 (GRCm39) missense probably damaging 1.00
R7454:Erc2 UTSW 14 28,024,948 (GRCm39) missense possibly damaging 0.92
R7763:Erc2 UTSW 14 27,598,161 (GRCm39) critical splice donor site probably null
R7784:Erc2 UTSW 14 27,620,551 (GRCm39) missense probably damaging 0.96
R7890:Erc2 UTSW 14 27,762,298 (GRCm39) critical splice acceptor site probably null
R7894:Erc2 UTSW 14 27,499,165 (GRCm39) missense probably damaging 1.00
R8031:Erc2 UTSW 14 27,733,649 (GRCm39) missense probably damaging 0.99
R8206:Erc2 UTSW 14 28,024,972 (GRCm39) splice site probably null
R8273:Erc2 UTSW 14 27,499,096 (GRCm39) missense probably benign 0.41
R8304:Erc2 UTSW 14 27,375,122 (GRCm39) missense probably damaging 0.99
R8387:Erc2 UTSW 14 27,375,253 (GRCm39) missense possibly damaging 0.92
R8751:Erc2 UTSW 14 27,802,145 (GRCm39) missense possibly damaging 0.78
R8851:Erc2 UTSW 14 28,039,216 (GRCm39) missense probably null 0.99
R9130:Erc2 UTSW 14 27,751,418 (GRCm39) missense probably benign 0.25
R9292:Erc2 UTSW 14 27,498,799 (GRCm39) missense probably damaging 1.00
R9441:Erc2 UTSW 14 27,802,114 (GRCm39) missense possibly damaging 0.58
R9452:Erc2 UTSW 14 27,733,690 (GRCm39) missense probably damaging 1.00
R9529:Erc2 UTSW 14 28,197,723 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CGTAGCTAGTTCCAAGAGTGTG -3'
(R):5'- TCAAAGAACGTATCACTCTATGCTG -3'

Sequencing Primer
(F):5'- CCTTTACCAAAGCTAATGGCGTAGC -3'
(R):5'- AAACTGACCTGGTCTGGA -3'
Posted On 2015-09-24