Incidental Mutation 'R4556:Erc2'
ID 341881
Institutional Source Beutler Lab
Gene Symbol Erc2
Ensembl Gene ENSMUSG00000040640
Gene Name ELKS/RAB6-interacting/CAST family member 2
Synonyms ELKS2alpha, D14Ertd171e
MMRRC Submission 041597-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4556 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 27622428-28478537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 28302904 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 580 (D580A)
Ref Sequence ENSEMBL: ENSMUSP00000147744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210924] [ENSMUST00000211145]
AlphaFold Q6PH08
Predicted Effect probably damaging
Transcript: ENSMUST00000090302
AA Change: D910A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: D910A

DomainStartEndE-ValueType
low complexity region 14 45 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
Pfam:Cast 150 907 N/A PFAM
low complexity region 916 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209800
Predicted Effect probably damaging
Transcript: ENSMUST00000210135
AA Change: D934A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000210924
AA Change: D580A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211145
AA Change: D914A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Ccdc109b G A 3: 129,915,735 Q310* probably null Het
Cdk5rap2 A G 4: 70,239,312 S1601P probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Fbxo42 T A 4: 141,199,010 H334Q probably damaging Het
Gdf5 A G 2: 155,941,862 R24G probably benign Het
Lama3 G T 18: 12,479,759 R1200L possibly damaging Het
Lxn T A 3: 67,458,620 I182F possibly damaging Het
Mbd5 G A 2: 49,279,394 G1526R probably damaging Het
Ndufaf7 T C 17: 78,942,087 S138P probably benign Het
Nktr A G 9: 121,741,123 T90A probably damaging Het
Nr1h5 G A 3: 102,946,141 A350V probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr868 T C 9: 20,101,323 L188P possibly damaging Het
Pros1 A G 16: 62,900,673 K197R possibly damaging Het
Rmnd5b G T 11: 51,626,905 probably null Het
Rnf25 A T 1: 74,599,105 I26N probably damaging Het
Scn4a T C 11: 106,320,446 I1582V probably benign Het
Sh2d3c A G 2: 32,753,009 T583A possibly damaging Het
Sh3tc1 T C 5: 35,707,082 Y587C probably damaging Het
Slc6a11 A G 6: 114,244,812 S488G probably benign Het
Smim22 T A 16: 5,007,866 F38L possibly damaging Het
Stab2 T G 10: 86,967,679 E335D possibly damaging Het
Tas2r102 T C 6: 132,762,915 F262S probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmem225 T C 9: 40,149,466 F107S probably damaging Het
Vmn1r229 T A 17: 20,814,691 V66E possibly damaging Het
Vmn1r27 A G 6: 58,215,819 S67P possibly damaging Het
Xrcc4 A T 13: 89,992,504 H195Q probably benign Het
Other mutations in Erc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Erc2 APN 14 28040521 missense probably damaging 0.98
IGL01862:Erc2 APN 14 28271569 splice site probably benign
IGL01906:Erc2 APN 14 28141306 missense probably damaging 0.99
IGL02177:Erc2 APN 14 27898623 missense probably benign 0.00
IGL02481:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02483:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02623:Erc2 APN 14 27776980 missense probably damaging 1.00
IGL03252:Erc2 APN 14 28475649 utr 3 prime probably benign
IGL03378:Erc2 APN 14 28011723 missense probably damaging 1.00
lobe UTSW 14 28317251 missense probably damaging 0.96
R0091:Erc2 UTSW 14 27776824 critical splice acceptor site probably null
R0309:Erc2 UTSW 14 28141225 missense probably damaging 0.98
R0357:Erc2 UTSW 14 27777022 missense probably damaging 0.99
R0378:Erc2 UTSW 14 28011694 missense probably damaging 1.00
R0550:Erc2 UTSW 14 28271651 missense possibly damaging 0.74
R0815:Erc2 UTSW 14 28025148 missense probably benign 0.04
R0863:Erc2 UTSW 14 28025148 missense probably benign 0.04
R1121:Erc2 UTSW 14 28475655 utr 3 prime probably benign
R1164:Erc2 UTSW 14 28302972 missense probably damaging 0.99
R1498:Erc2 UTSW 14 28302898 missense probably benign 0.27
R1500:Erc2 UTSW 14 28271660 missense probably damaging 0.98
R1555:Erc2 UTSW 14 28011665 missense probably damaging 0.99
R1894:Erc2 UTSW 14 28141228 missense probably damaging 0.99
R1950:Erc2 UTSW 14 27912900 missense probably damaging 0.99
R1991:Erc2 UTSW 14 28011636 missense probably benign 0.34
R2698:Erc2 UTSW 14 28271705 missense probably benign 0.06
R2847:Erc2 UTSW 14 28040488 missense probably damaging 0.97
R3015:Erc2 UTSW 14 28011775 critical splice donor site probably null
R3612:Erc2 UTSW 14 27777177 missense possibly damaging 0.69
R3759:Erc2 UTSW 14 28025163 missense possibly damaging 0.94
R3857:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3858:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3859:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R4739:Erc2 UTSW 14 27776881 missense probably damaging 1.00
R4898:Erc2 UTSW 14 27653328 missense probably damaging 1.00
R5068:Erc2 UTSW 14 28302943 missense possibly damaging 0.63
R5113:Erc2 UTSW 14 27652872 missense probably benign 0.40
R5418:Erc2 UTSW 14 27966510 missense probably benign 0.14
R5741:Erc2 UTSW 14 28302869 splice site probably null
R5819:Erc2 UTSW 14 28141369 missense probably damaging 0.97
R5930:Erc2 UTSW 14 27776858 missense probably damaging 0.99
R6073:Erc2 UTSW 14 28011636 missense probably benign 0.00
R6150:Erc2 UTSW 14 28141291 missense probably damaging 0.97
R6182:Erc2 UTSW 14 28317253 missense probably damaging 0.99
R6188:Erc2 UTSW 14 28317251 missense probably damaging 0.96
R6267:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6296:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6730:Erc2 UTSW 14 27898567 missense possibly damaging 0.95
R6969:Erc2 UTSW 14 27898596 missense probably damaging 1.00
R7095:Erc2 UTSW 14 27898593 missense probably damaging 0.99
R7221:Erc2 UTSW 14 27653158 missense probably damaging 0.97
R7365:Erc2 UTSW 14 28040389 missense probably damaging 1.00
R7454:Erc2 UTSW 14 28302991 missense possibly damaging 0.92
R7763:Erc2 UTSW 14 27876204 critical splice donor site probably null
R7784:Erc2 UTSW 14 27898594 missense probably damaging 0.96
R7890:Erc2 UTSW 14 28040341 critical splice acceptor site probably null
R7894:Erc2 UTSW 14 27777208 missense probably damaging 1.00
R8031:Erc2 UTSW 14 28011692 missense probably damaging 0.99
R8206:Erc2 UTSW 14 28303015 splice site probably null
R8273:Erc2 UTSW 14 27777139 missense probably benign 0.41
R8304:Erc2 UTSW 14 27653165 missense probably damaging 0.99
R8387:Erc2 UTSW 14 27653296 missense possibly damaging 0.92
R8751:Erc2 UTSW 14 28080188 missense possibly damaging 0.78
R8851:Erc2 UTSW 14 28317259 missense probably null 0.99
R9130:Erc2 UTSW 14 28029461 missense probably benign 0.25
R9292:Erc2 UTSW 14 27776842 missense probably damaging 1.00
R9441:Erc2 UTSW 14 28080157 missense possibly damaging 0.58
R9452:Erc2 UTSW 14 28011733 missense probably damaging 1.00
R9529:Erc2 UTSW 14 28475766 missense unknown
Predicted Primers PCR Primer
(F):5'- CGTAGCTAGTTCCAAGAGTGTG -3'
(R):5'- TCAAAGAACGTATCACTCTATGCTG -3'

Sequencing Primer
(F):5'- CCTTTACCAAAGCTAATGGCGTAGC -3'
(R):5'- AAACTGACCTGGTCTGGA -3'
Posted On 2015-09-24