Mutagenetix > Incidental Mutation

Incidental Mutation 'R4556:Pros1'

341884

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

041597-MU

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4556 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62900673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 197 (K197R)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023629
AA Change: K197R

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: K197R

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155940

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830005F24Rik	T	C	13: 48,514,461		probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Adamts17	A	T	7: 67,027,893	E518D	probably damaging	Het
Ccdc109b	G	A	3: 129,915,735	Q310*	probably null	Het
Cdk5rap2	A	G	4: 70,239,312	S1601P	probably damaging	Het
Erc2	A	C	14: 28,302,904	D580A	probably damaging	Het
Fbxo4	A	G	15: 3,965,705	*386R	probably null	Het
Fbxo42	T	A	4: 141,199,010	H334Q	probably damaging	Het
Gdf5	A	G	2: 155,941,862	R24G	probably benign	Het
Lama3	G	T	18: 12,479,759	R1200L	possibly damaging	Het
Lxn	T	A	3: 67,458,620	I182F	possibly damaging	Het
Mbd5	G	A	2: 49,279,394	G1526R	probably damaging	Het
Ndufaf7	T	C	17: 78,942,087	S138P	probably benign	Het
Nktr	A	G	9: 121,741,123	T90A	probably damaging	Het
Nr1h5	G	A	3: 102,946,141	A350V	probably benign	Het
Olfr389	G	A	11: 73,776,481	T282I	possibly damaging	Het
Olfr868	T	C	9: 20,101,323	L188P	possibly damaging	Het
Rmnd5b	G	T	11: 51,626,905		probably null	Het
Rnf25	A	T	1: 74,599,105	I26N	probably damaging	Het
Scn4a	T	C	11: 106,320,446	I1582V	probably benign	Het
Sh2d3c	A	G	2: 32,753,009	T583A	possibly damaging	Het
Sh3tc1	T	C	5: 35,707,082	Y587C	probably damaging	Het
Slc6a11	A	G	6: 114,244,812	S488G	probably benign	Het
Smim22	T	A	16: 5,007,866	F38L	possibly damaging	Het
Stab2	T	G	10: 86,967,679	E335D	possibly damaging	Het
Tas2r102	T	C	6: 132,762,915	F262S	probably damaging	Het
Thap12	A	G	7: 98,715,845	N407D	probably benign	Het
Tmem225	T	C	9: 40,149,466	F107S	probably damaging	Het
Vmn1r229	T	A	17: 20,814,691	V66E	possibly damaging	Het
Vmn1r27	A	G	6: 58,215,819	S67P	possibly damaging	Het
Xrcc4	A	T	13: 89,992,504	H195Q	probably benign	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TGGGATGGTTGCATTACAAATC -3'
(R):5'- GGGCATATGCACACCCAAGAAG -3'

Sequencing Primer
(F):5'- GGGATGGTTGCATTACAAATCATCTG -3'
(R):5'- CCCAAGAAGAACATGAAATAGTCTTG -3'

Posted On

2015-09-24