Incidental Mutation 'R4556:Pros1'
ID 341884
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Name protein S (alpha)
Synonyms protein S
MMRRC Submission 041597-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4556 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 62674670-62749709 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62721036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 197 (K197R)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
AlphaFold Q08761
Predicted Effect possibly damaging
Transcript: ENSMUST00000023629
AA Change: K197R

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: K197R

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155940
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,667,937 (GRCm39) probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adamts17 A T 7: 66,677,641 (GRCm39) E518D probably damaging Het
Cdk5rap2 A G 4: 70,157,549 (GRCm39) S1601P probably damaging Het
Erc2 A C 14: 28,024,861 (GRCm39) D580A probably damaging Het
Fbxo4 A G 15: 3,995,187 (GRCm39) *386R probably null Het
Fbxo42 T A 4: 140,926,321 (GRCm39) H334Q probably damaging Het
Gdf5 A G 2: 155,783,782 (GRCm39) R24G probably benign Het
Lama3 G T 18: 12,612,816 (GRCm39) R1200L possibly damaging Het
Lxn T A 3: 67,365,953 (GRCm39) I182F possibly damaging Het
Mbd5 G A 2: 49,169,406 (GRCm39) G1526R probably damaging Het
Mcub G A 3: 129,709,384 (GRCm39) Q310* probably null Het
Ndufaf7 T C 17: 79,249,516 (GRCm39) S138P probably benign Het
Nktr A G 9: 121,570,189 (GRCm39) T90A probably damaging Het
Nr1h5 G A 3: 102,853,457 (GRCm39) A350V probably benign Het
Or1e29 G A 11: 73,667,307 (GRCm39) T282I possibly damaging Het
Or7e174 T C 9: 20,012,619 (GRCm39) L188P possibly damaging Het
Rmnd5b G T 11: 51,517,732 (GRCm39) probably null Het
Rnf25 A T 1: 74,638,264 (GRCm39) I26N probably damaging Het
Scn4a T C 11: 106,211,272 (GRCm39) I1582V probably benign Het
Sh2d3c A G 2: 32,643,021 (GRCm39) T583A possibly damaging Het
Sh3tc1 T C 5: 35,864,426 (GRCm39) Y587C probably damaging Het
Slc6a11 A G 6: 114,221,773 (GRCm39) S488G probably benign Het
Smim22 T A 16: 4,825,730 (GRCm39) F38L possibly damaging Het
Stab2 T G 10: 86,803,543 (GRCm39) E335D possibly damaging Het
Tas2r102 T C 6: 132,739,878 (GRCm39) F262S probably damaging Het
Thap12 A G 7: 98,365,052 (GRCm39) N407D probably benign Het
Tmem225 T C 9: 40,060,762 (GRCm39) F107S probably damaging Het
Vmn1r229 T A 17: 21,034,953 (GRCm39) V66E possibly damaging Het
Vmn1r27 A G 6: 58,192,804 (GRCm39) S67P possibly damaging Het
Xrcc4 A T 13: 90,140,623 (GRCm39) H195Q probably benign Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62,730,408 (GRCm39) missense probably damaging 0.99
IGL01300:Pros1 APN 16 62,734,174 (GRCm39) missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62,719,308 (GRCm39) missense probably damaging 0.99
IGL03080:Pros1 APN 16 62,738,506 (GRCm39) missense probably damaging 0.98
IGL03095:Pros1 APN 16 62,728,132 (GRCm39) nonsense probably null
F6893:Pros1 UTSW 16 62,745,002 (GRCm39) missense probably damaging 0.98
R0124:Pros1 UTSW 16 62,734,309 (GRCm39) missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62,723,881 (GRCm39) missense probably benign 0.03
R1113:Pros1 UTSW 16 62,734,228 (GRCm39) missense probably damaging 0.99
R1308:Pros1 UTSW 16 62,734,228 (GRCm39) missense probably damaging 0.99
R1355:Pros1 UTSW 16 62,739,921 (GRCm39) missense probably benign 0.23
R1370:Pros1 UTSW 16 62,739,921 (GRCm39) missense probably benign 0.23
R1517:Pros1 UTSW 16 62,705,875 (GRCm39) missense probably damaging 0.98
R1866:Pros1 UTSW 16 62,748,498 (GRCm39) missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62,723,881 (GRCm39) missense probably damaging 0.96
R2255:Pros1 UTSW 16 62,723,935 (GRCm39) missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62,734,211 (GRCm39) missense probably damaging 0.99
R2369:Pros1 UTSW 16 62,748,432 (GRCm39) missense probably damaging 1.00
R2979:Pros1 UTSW 16 62,734,229 (GRCm39) missense probably damaging 0.99
R3724:Pros1 UTSW 16 62,720,692 (GRCm39) missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62,721,008 (GRCm39) nonsense probably null
R4688:Pros1 UTSW 16 62,709,370 (GRCm39) critical splice donor site probably null
R4850:Pros1 UTSW 16 62,705,887 (GRCm39) missense probably damaging 0.98
R4923:Pros1 UTSW 16 62,723,935 (GRCm39) missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62,748,548 (GRCm39) missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62,734,339 (GRCm39) missense probably benign 0.01
R5580:Pros1 UTSW 16 62,746,689 (GRCm39) critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62,748,424 (GRCm39) missense probably damaging 0.96
R5974:Pros1 UTSW 16 62,721,030 (GRCm39) missense probably damaging 0.98
R6233:Pros1 UTSW 16 62,719,284 (GRCm39) missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62,744,938 (GRCm39) missense probably benign 0.01
R7055:Pros1 UTSW 16 62,748,465 (GRCm39) missense possibly damaging 0.85
R7347:Pros1 UTSW 16 62,739,886 (GRCm39) missense probably damaging 0.97
R7375:Pros1 UTSW 16 62,744,913 (GRCm39) missense probably damaging 0.96
R7419:Pros1 UTSW 16 62,748,433 (GRCm39) nonsense probably null
R7980:Pros1 UTSW 16 62,748,516 (GRCm39) missense possibly damaging 0.86
R8234:Pros1 UTSW 16 62,748,540 (GRCm39) missense possibly damaging 0.73
R8479:Pros1 UTSW 16 62,728,102 (GRCm39) missense probably damaging 1.00
R8514:Pros1 UTSW 16 62,730,472 (GRCm39) missense probably benign 0.03
R8827:Pros1 UTSW 16 62,746,827 (GRCm39) missense probably benign 0.13
R9131:Pros1 UTSW 16 62,748,397 (GRCm39) missense probably damaging 0.96
R9484:Pros1 UTSW 16 62,744,887 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGGATGGTTGCATTACAAATC -3'
(R):5'- GGGCATATGCACACCCAAGAAG -3'

Sequencing Primer
(F):5'- GGGATGGTTGCATTACAAATCATCTG -3'
(R):5'- CCCAAGAAGAACATGAAATAGTCTTG -3'
Posted On 2015-09-24