Mutagenetix > Incidental Mutations

Incidental Mutation 'R4557:Slc12a1'

341891

Institutional Source

Beutler Lab

Gene Symbol

Slc12a1

Ensembl Gene

ENSMUSG00000027202

Gene Name

solute carrier family 12, member 1

Synonyms

urehr3, mBSC1, Nkcc2, D630042G03Rik

MMRRC Submission

041784-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.294) question?

Stock #

R4557 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125152505-125230002 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125186641 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 517 (N517S)

Ref Sequence

ENSEMBL: ENSMUSP00000028630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028630] [ENSMUST00000110494] [ENSMUST00000110495]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028630
AA Change: N517S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028630
Gene: ENSMUSG00000027202
AA Change: N517S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:AA_permease_N	82	152	5.3e-22	PFAM
Pfam:AA_permease	173	677	2.3e-152	PFAM
Pfam:AA_permease_2	177	636	2.6e-24	PFAM
coiled coil region	815	843	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110494
AA Change: N517S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000106120
Gene: ENSMUSG00000027202
AA Change: N517S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:AA_permease_N	83	148	3.3e-26	PFAM
Pfam:AA_permease	173	677	2.2e-151	PFAM
Pfam:SLC12	685	1090	1.5e-153	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110495
AA Change: N517S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106121
Gene: ENSMUSG00000027202
AA Change: N517S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:AA_permease_N	83	148	3.3e-26	PFAM
Pfam:AA_permease	173	677	1.6e-151	PFAM
Pfam:SLC12	685	1090	1.5e-153	PFAM

Meta Mutation Damage Score

0.1759

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene do not survive to weaning and suffer from various metabolic abnormalities related to kidney function. Mice homozygous for an ENU-induced allele exhibit kidney disease, impaired urinary excretion of metabolism products, polyuria, and kidney alterations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830005F24Rik	T	C	13: 48,514,461		probably benign	Het
Acad11	T	C	9: 104,082,839	F219L	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Adamts17	A	T	7: 67,027,893	E518D	probably damaging	Het
Adamts3	A	G	5: 89,700,487	Y659H	probably benign	Het
Adgrb3	T	C	1: 25,084,279	R1414G	probably damaging	Het
Apba1	T	A	19: 23,917,592	I464N	probably damaging	Het
Bahcc1	A	G	11: 120,275,088	T1057A	probably damaging	Het
Bcl11a	A	G	11: 24,164,004	E449G	probably damaging	Het
Ccdc162	T	A	10: 41,587,388	I1453L	probably benign	Het
Ccdc175	T	A	12: 72,128,306	E531V	probably benign	Het
Cep68	A	T	11: 20,239,113		probably benign	Het
Dlgap1	C	A	17: 70,516,689	T223K	probably benign	Het
Exoc1	G	A	5: 76,561,443	V24M	probably damaging	Het
Fbxo4	A	G	15: 3,965,705	*386R	probably null	Het
Gm10100	G	A	10: 77,726,531		probably benign	Het
Gpr149	A	G	3: 62,530,870	V622A	probably damaging	Het
Gpr149	A	C	3: 62,604,497	M27R	probably benign	Het
Ighv3-6	T	C	12: 114,288,198	N101D	probably benign	Het
Igkv4-78	A	G	6: 69,059,771	S93P	possibly damaging	Het
Kmt2c	A	T	5: 25,300,315	W3332R	probably damaging	Het
Marf1	T	C	16: 14,153,977		probably benign	Het
Mcrs1	A	G	15: 99,243,147	I459T	probably benign	Het
Mdn1	G	T	4: 32,754,437	C4646F	probably damaging	Het
Med17	T	C	9: 15,271,697	K351E	possibly damaging	Het
Nalcn	T	C	14: 123,321,235		probably benign	Het
Olfr389	G	A	11: 73,776,481	T282I	possibly damaging	Het
Olfr398	A	T	11: 73,984,599	V3E	probably benign	Het
Olfr761	C	A	17: 37,952,251	A258S	probably benign	Het
Olfr816	A	G	10: 129,911,529	Y250H	probably damaging	Het
Phrf1	C	T	7: 141,258,929		probably benign	Het
Pitpnm1	A	G	19: 4,103,085	Q135R	probably benign	Het
Prdm16	T	A	4: 154,528,827	M48L	probably benign	Het
Ptpn13	A	G	5: 103,541,110	E923G	probably damaging	Het
Rp1	A	T	1: 4,344,663	S2075R	possibly damaging	Het
Sft2d2	A	G	1: 165,183,984	C114R	probably damaging	Het
Sipa1l2	T	G	8: 125,464,415	R945S	probably damaging	Het
Slc44a2	T	G	9: 21,346,783	L443R	possibly damaging	Het
Smok4a	T	C	17: 13,526,381		noncoding transcript	Het
Snx18	A	G	13: 113,617,828	S190P	probably damaging	Het
Thap12	A	G	7: 98,715,845	N407D	probably benign	Het
Tmc5	T	C	7: 118,670,733	I902T	probably benign	Het
Ttc27	T	G	17: 74,829,549	S584A	probably benign	Het
Ttn	A	T	2: 76,949,015	Y1174N	probably damaging	Het
Zbtb44	T	G	9: 31,064,248	S391R	probably damaging	Het

Other mutations in Slc12a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00798:Slc12a1	APN	2	125188194	missense	probably damaging	1.00
IGL00845:Slc12a1	APN	2	125188238	missense	probably damaging	1.00
IGL01348:Slc12a1	APN	2	125194131	missense	probably damaging	1.00
IGL01534:Slc12a1	APN	2	125217910	missense	probably damaging	1.00
IGL01677:Slc12a1	APN	2	125178149	splice site	probably benign
IGL02150:Slc12a1	APN	2	125184815	missense	probably damaging	1.00
IGL02220:Slc12a1	APN	2	125188270	critical splice donor site	probably null
IGL02568:Slc12a1	APN	2	125184728	missense	probably damaging	1.00
IGL02602:Slc12a1	APN	2	125154242	missense	probably damaging	1.00
IGL02625:Slc12a1	APN	2	125170691	missense	probably damaging	1.00
IGL02635:Slc12a1	APN	2	125225978	missense	probably benign
IGL02672:Slc12a1	APN	2	125170676	missense	probably damaging	1.00
IGL02718:Slc12a1	APN	2	125161079	nonsense	probably null
IGL03191:Slc12a1	APN	2	125206089	missense	possibly damaging	0.87
FR4449:Slc12a1	UTSW	2	125154216	small insertion	probably benign
FR4548:Slc12a1	UTSW	2	125154214	small insertion	probably benign
FR4737:Slc12a1	UTSW	2	125154214	small insertion	probably benign
PIT4431001:Slc12a1	UTSW	2	125190204	missense	possibly damaging	0.78
R0033:Slc12a1	UTSW	2	125214009	missense	probably benign
R0127:Slc12a1	UTSW	2	125219762	missense	probably damaging	1.00
R0312:Slc12a1	UTSW	2	125226028	missense	probably damaging	0.98
R0373:Slc12a1	UTSW	2	125226031	missense	probably damaging	1.00
R0692:Slc12a1	UTSW	2	125194162	nonsense	probably null
R1194:Slc12a1	UTSW	2	125184767	missense	probably benign	0.00
R1264:Slc12a1	UTSW	2	125218238	missense	possibly damaging	0.56
R1529:Slc12a1	UTSW	2	125190295	missense	probably damaging	1.00
R1543:Slc12a1	UTSW	2	125184857	missense	possibly damaging	0.93
R1940:Slc12a1	UTSW	2	125194193	missense	probably benign	0.05
R2109:Slc12a1	UTSW	2	125173699	missense	probably damaging	1.00
R2167:Slc12a1	UTSW	2	125173681	missense	probably damaging	1.00
R3409:Slc12a1	UTSW	2	125154151	missense	probably benign	0.00
R3902:Slc12a1	UTSW	2	125188193	missense	probably damaging	1.00
R4079:Slc12a1	UTSW	2	125200623	missense	possibly damaging	0.86
R4502:Slc12a1	UTSW	2	125226044	missense	probably damaging	1.00
R4719:Slc12a1	UTSW	2	125153993	missense	possibly damaging	0.82
R4782:Slc12a1	UTSW	2	125161079	nonsense	probably null
R4845:Slc12a1	UTSW	2	125188226	missense	probably damaging	1.00
R4913:Slc12a1	UTSW	2	125228750	missense	probably damaging	0.96
R5024:Slc12a1	UTSW	2	125166137	missense	probably benign	0.00
R5112:Slc12a1	UTSW	2	125218224	missense	possibly damaging	0.63
R5334:Slc12a1	UTSW	2	125217889	missense	probably damaging	1.00
R5470:Slc12a1	UTSW	2	125170714	missense	probably damaging	1.00
R6057:Slc12a1	UTSW	2	125190213	missense	probably damaging	1.00
R6604:Slc12a1	UTSW	2	125184815	missense	probably damaging	1.00
R6941:Slc12a1	UTSW	2	125214079	missense	possibly damaging	0.85
R6944:Slc12a1	UTSW	2	125160534	missense	probably damaging	0.97
R7049:Slc12a1	UTSW	2	125171257	missense	probably benign	0.04
R7204:Slc12a1	UTSW	2	125200622	missense	possibly damaging	0.93
R7427:Slc12a1	UTSW	2	125214132	missense	probably benign
R7428:Slc12a1	UTSW	2	125214132	missense	probably benign
R7432:Slc12a1	UTSW	2	125206040	missense	probably benign	0.36
R7470:Slc12a1	UTSW	2	125217895	nonsense	probably null
R7828:Slc12a1	UTSW	2	125166682	missense	possibly damaging	0.85
R7862:Slc12a1	UTSW	2	125161094	missense	probably damaging	0.99
R7923:Slc12a1	UTSW	2	125214092	missense	possibly damaging	0.75
R8020:Slc12a1	UTSW	2	125178102	missense	possibly damaging	0.78
R8071:Slc12a1	UTSW	2	125186314	missense	probably damaging	1.00
R8272:Slc12a1	UTSW	2	125228816	missense	probably damaging	1.00
R8302:Slc12a1	UTSW	2	125190289	missense	probably damaging	0.99
RF032:Slc12a1	UTSW	2	125154210	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCTAGCTCAAGTGCTGTGC -3'
(R):5'- AACCTGCTAACGACTCTACG -3'

Sequencing Primer
(F):5'- GTGCCTGCCACATAGTCAAG -3'
(R):5'- TCTACGAGCAAAAGGCCG -3'

Posted On

2015-09-24