Incidental Mutation 'R4557:Slc12a1'
ID341891
Institutional Source Beutler Lab
Gene Symbol Slc12a1
Ensembl Gene ENSMUSG00000027202
Gene Namesolute carrier family 12, member 1
Synonymsurehr3, mBSC1, Nkcc2, D630042G03Rik
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125152505-125230002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125186641 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 517 (N517S)
Ref Sequence ENSEMBL: ENSMUSP00000028630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028630] [ENSMUST00000110494] [ENSMUST00000110495]
Predicted Effect probably damaging
Transcript: ENSMUST00000028630
AA Change: N517S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028630
Gene: ENSMUSG00000027202
AA Change: N517S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 82 152 5.3e-22 PFAM
Pfam:AA_permease 173 677 2.3e-152 PFAM
Pfam:AA_permease_2 177 636 2.6e-24 PFAM
coiled coil region 815 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110494
AA Change: N517S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106120
Gene: ENSMUSG00000027202
AA Change: N517S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 2.2e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110495
AA Change: N517S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106121
Gene: ENSMUSG00000027202
AA Change: N517S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 1.6e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Meta Mutation Damage Score 0.1759 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene do not survive to weaning and suffer from various metabolic abnormalities related to kidney function. Mice homozygous for an ENU-induced allele exhibit kidney disease, impaired urinary excretion of metabolism products, polyuria, and kidney alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Slc12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Slc12a1 APN 2 125188194 missense probably damaging 1.00
IGL00845:Slc12a1 APN 2 125188238 missense probably damaging 1.00
IGL01348:Slc12a1 APN 2 125194131 missense probably damaging 1.00
IGL01534:Slc12a1 APN 2 125217910 missense probably damaging 1.00
IGL01677:Slc12a1 APN 2 125178149 splice site probably benign
IGL02150:Slc12a1 APN 2 125184815 missense probably damaging 1.00
IGL02220:Slc12a1 APN 2 125188270 critical splice donor site probably null
IGL02568:Slc12a1 APN 2 125184728 missense probably damaging 1.00
IGL02602:Slc12a1 APN 2 125154242 missense probably damaging 1.00
IGL02625:Slc12a1 APN 2 125170691 missense probably damaging 1.00
IGL02635:Slc12a1 APN 2 125225978 missense probably benign
IGL02672:Slc12a1 APN 2 125170676 missense probably damaging 1.00
IGL02718:Slc12a1 APN 2 125161079 nonsense probably null
IGL03191:Slc12a1 APN 2 125206089 missense possibly damaging 0.87
FR4449:Slc12a1 UTSW 2 125154216 small insertion probably benign
FR4548:Slc12a1 UTSW 2 125154214 small insertion probably benign
FR4737:Slc12a1 UTSW 2 125154214 small insertion probably benign
PIT4431001:Slc12a1 UTSW 2 125190204 missense possibly damaging 0.78
R0033:Slc12a1 UTSW 2 125214009 missense probably benign
R0127:Slc12a1 UTSW 2 125219762 missense probably damaging 1.00
R0312:Slc12a1 UTSW 2 125226028 missense probably damaging 0.98
R0373:Slc12a1 UTSW 2 125226031 missense probably damaging 1.00
R0692:Slc12a1 UTSW 2 125194162 nonsense probably null
R1194:Slc12a1 UTSW 2 125184767 missense probably benign 0.00
R1264:Slc12a1 UTSW 2 125218238 missense possibly damaging 0.56
R1529:Slc12a1 UTSW 2 125190295 missense probably damaging 1.00
R1543:Slc12a1 UTSW 2 125184857 missense possibly damaging 0.93
R1940:Slc12a1 UTSW 2 125194193 missense probably benign 0.05
R2109:Slc12a1 UTSW 2 125173699 missense probably damaging 1.00
R2167:Slc12a1 UTSW 2 125173681 missense probably damaging 1.00
R3409:Slc12a1 UTSW 2 125154151 missense probably benign 0.00
R3902:Slc12a1 UTSW 2 125188193 missense probably damaging 1.00
R4079:Slc12a1 UTSW 2 125200623 missense possibly damaging 0.86
R4502:Slc12a1 UTSW 2 125226044 missense probably damaging 1.00
R4719:Slc12a1 UTSW 2 125153993 missense possibly damaging 0.82
R4782:Slc12a1 UTSW 2 125161079 nonsense probably null
R4845:Slc12a1 UTSW 2 125188226 missense probably damaging 1.00
R4913:Slc12a1 UTSW 2 125228750 missense probably damaging 0.96
R5024:Slc12a1 UTSW 2 125166137 missense probably benign 0.00
R5112:Slc12a1 UTSW 2 125218224 missense possibly damaging 0.63
R5334:Slc12a1 UTSW 2 125217889 missense probably damaging 1.00
R5470:Slc12a1 UTSW 2 125170714 missense probably damaging 1.00
R6057:Slc12a1 UTSW 2 125190213 missense probably damaging 1.00
R6604:Slc12a1 UTSW 2 125184815 missense probably damaging 1.00
R6941:Slc12a1 UTSW 2 125214079 missense possibly damaging 0.85
R6944:Slc12a1 UTSW 2 125160534 missense probably damaging 0.97
R7049:Slc12a1 UTSW 2 125171257 missense probably benign 0.04
R7204:Slc12a1 UTSW 2 125200622 missense possibly damaging 0.93
R7427:Slc12a1 UTSW 2 125214132 missense probably benign
R7428:Slc12a1 UTSW 2 125214132 missense probably benign
R7432:Slc12a1 UTSW 2 125206040 missense probably benign 0.36
R7470:Slc12a1 UTSW 2 125217895 nonsense probably null
R7828:Slc12a1 UTSW 2 125166682 missense possibly damaging 0.85
R7862:Slc12a1 UTSW 2 125161094 missense probably damaging 0.99
R7923:Slc12a1 UTSW 2 125214092 missense possibly damaging 0.75
R8020:Slc12a1 UTSW 2 125178102 missense possibly damaging 0.78
R8071:Slc12a1 UTSW 2 125186314 missense probably damaging 1.00
R8272:Slc12a1 UTSW 2 125228816 missense probably damaging 1.00
R8302:Slc12a1 UTSW 2 125190289 missense probably damaging 0.99
RF032:Slc12a1 UTSW 2 125154210 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATCTAGCTCAAGTGCTGTGC -3'
(R):5'- AACCTGCTAACGACTCTACG -3'

Sequencing Primer
(F):5'- GTGCCTGCCACATAGTCAAG -3'
(R):5'- TCTACGAGCAAAAGGCCG -3'
Posted On2015-09-24