Incidental Mutation 'R4557:Gpr149'
ID341892
Institutional Source Beutler Lab
Gene Symbol Gpr149
Ensembl Gene ENSMUSG00000043441
Gene NameG protein-coupled receptor 149
SynonymsPGR10, R35, Ieda, 9630018L10Rik
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location62529077-62605140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62530870 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 622 (V622A)
Ref Sequence ENSEMBL: ENSMUSP00000060893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058535]
Predicted Effect probably damaging
Transcript: ENSMUST00000058535
AA Change: V622A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060893
Gene: ENSMUSG00000043441
AA Change: V622A

DomainStartEndE-ValueType
Pfam:7tm_1 52 363 7.2e-7 PFAM
coiled coil region 694 730 N/A INTRINSIC
Meta Mutation Damage Score 0.3616 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit increased fertility with increased litter size and frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Gpr149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Gpr149 APN 3 62530673 missense probably damaging 1.00
IGL01339:Gpr149 APN 3 62604297 missense probably damaging 1.00
IGL01399:Gpr149 APN 3 62604431 missense probably damaging 1.00
IGL01954:Gpr149 APN 3 62530927 missense probably benign 0.36
IGL02115:Gpr149 APN 3 62594915 missense probably benign 0.02
IGL02218:Gpr149 APN 3 62530531 utr 3 prime probably benign
IGL02592:Gpr149 APN 3 62603810 missense possibly damaging 0.75
IGL03393:Gpr149 APN 3 62603945 missense probably benign 0.15
R0578:Gpr149 UTSW 3 62602689 missense possibly damaging 0.81
R1173:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1174:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1175:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1432:Gpr149 UTSW 3 62531018 missense probably damaging 1.00
R1484:Gpr149 UTSW 3 62595171 missense probably benign 0.00
R1972:Gpr149 UTSW 3 62530795 missense probably benign 0.39
R1973:Gpr149 UTSW 3 62530795 missense probably benign 0.39
R2180:Gpr149 UTSW 3 62604068 missense probably damaging 1.00
R2241:Gpr149 UTSW 3 62604053 missense probably benign 0.00
R3118:Gpr149 UTSW 3 62595022 missense probably benign 0.00
R3547:Gpr149 UTSW 3 62595128 missense probably benign 0.01
R3548:Gpr149 UTSW 3 62595128 missense probably benign 0.01
R4206:Gpr149 UTSW 3 62604503 missense possibly damaging 0.92
R4332:Gpr149 UTSW 3 62604373 missense possibly damaging 0.93
R4531:Gpr149 UTSW 3 62602678 missense probably benign 0.00
R4557:Gpr149 UTSW 3 62604497 missense probably benign 0.02
R4593:Gpr149 UTSW 3 62602730 intron probably benign
R5397:Gpr149 UTSW 3 62530805 missense probably damaging 1.00
R6592:Gpr149 UTSW 3 62530540 missense probably benign 0.02
R6642:Gpr149 UTSW 3 62530574 missense probably damaging 1.00
R6845:Gpr149 UTSW 3 62604521 missense possibly damaging 0.58
R7303:Gpr149 UTSW 3 62595070 missense possibly damaging 0.59
R7659:Gpr149 UTSW 3 62603835 missense probably benign 0.01
R7682:Gpr149 UTSW 3 62530739 missense probably damaging 1.00
R7803:Gpr149 UTSW 3 62530715 missense probably damaging 1.00
R7904:Gpr149 UTSW 3 62594935 missense probably benign 0.00
R7943:Gpr149 UTSW 3 62530711 missense probably damaging 1.00
Z1177:Gpr149 UTSW 3 62603959 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCATCAGGATCACTTGTGGG -3'
(R):5'- ATTCCCATATGCGCGTTCCAG -3'

Sequencing Primer
(F):5'- CATCAGGATCACTTGTGGGTAAAAAG -3'
(R):5'- GGACTGTGTCTCTCCAAGCAC -3'
Posted On2015-09-24