Incidental Mutation 'R4557:Prdm16'
ID341895
Institutional Source Beutler Lab
Gene Symbol Prdm16
Ensembl Gene ENSMUSG00000039410
Gene NamePR domain containing 16
SynonymsMel1, 5730557K01Rik, csp1, line 27
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.795) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154316125-154636873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154528827 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 48 (M48L)
Ref Sequence ENSEMBL: ENSMUSP00000117598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030902] [ENSMUST00000070313] [ENSMUST00000097759] [ENSMUST00000105636] [ENSMUST00000105637] [ENSMUST00000105638] [ENSMUST00000124771]
Predicted Effect probably benign
Transcript: ENSMUST00000030902
AA Change: M48L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030902
Gene: ENSMUSG00000039410
AA Change: M48L

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 951 973 5.29e-5 SMART
ZnF_C2H2 979 1002 1.6e-4 SMART
ZnF_C2H2 1008 1030 7.26e-3 SMART
low complexity region 1116 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070313
AA Change: M48L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000064546
Gene: ENSMUSG00000039410
AA Change: M48L

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 953 975 5.29e-5 SMART
ZnF_C2H2 981 1004 1.6e-4 SMART
ZnF_C2H2 1010 1032 7.26e-3 SMART
low complexity region 1118 1134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097759
AA Change: M48L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095365
Gene: ENSMUSG00000039410
AA Change: M48L

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105636
AA Change: M48L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101261
Gene: ENSMUSG00000039410
AA Change: M48L

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105637
AA Change: M48L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000101262
Gene: ENSMUSG00000039410
AA Change: M48L

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 216 8.75e-5 SMART
ZnF_C2H2 229 249 2.82e1 SMART
low complexity region 259 273 N/A INTRINSIC
ZnF_C2H2 281 303 1.04e-3 SMART
ZnF_C2H2 309 331 1.6e-4 SMART
ZnF_C2H2 337 360 3.95e-4 SMART
ZnF_C2H2 366 388 1.95e-3 SMART
ZnF_C2H2 394 416 8.22e-2 SMART
ZnF_C2H2 423 450 9.96e0 SMART
low complexity region 495 516 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 609 640 N/A INTRINSIC
ZnF_C2H2 950 972 5.29e-5 SMART
ZnF_C2H2 978 1001 1.6e-4 SMART
ZnF_C2H2 1007 1029 7.26e-3 SMART
low complexity region 1115 1131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105638
AA Change: M48L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101263
Gene: ENSMUSG00000039410
AA Change: M48L

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124771
AA Change: M48L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117598
Gene: ENSMUSG00000039410
AA Change: M48L

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 213 8.04e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149605
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reciprocal translocation t(1;3)(p36;q21) occurs in a subset of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). This gene is located near the 1p36.3 breakpoint and has been shown to be specifically expressed in the t(1:3)(p36,q21)-positive MDS/AML. The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal PR domain. The translocation results in the overexpression of a truncated version of this protein that lacks the PR domain, which may play an important role in the pathogenesis of MDS and AML. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice exhibit a cleft secondary palate, whitening of brown adipose tissue in older or fed a high-fat diet, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Prdm16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Prdm16 APN 4 154341969 missense possibly damaging 0.89
IGL01517:Prdm16 APN 4 154328425 missense probably damaging 1.00
IGL01810:Prdm16 APN 4 154347927 missense probably benign 0.10
IGL02260:Prdm16 APN 4 154328287 missense probably benign 0.00
IGL02623:Prdm16 APN 4 154340877 missense probably damaging 0.98
IGL02744:Prdm16 APN 4 154345453 missense probably damaging 1.00
R0126:Prdm16 UTSW 4 154328838 splice site probably benign
R0345:Prdm16 UTSW 4 154341111 missense probably benign 0.09
R0365:Prdm16 UTSW 4 154342056 missense probably damaging 1.00
R0440:Prdm16 UTSW 4 154476627 splice site probably benign
R0899:Prdm16 UTSW 4 154528909 missense probably damaging 1.00
R1127:Prdm16 UTSW 4 154528799 missense probably damaging 1.00
R1546:Prdm16 UTSW 4 154528660 missense possibly damaging 0.94
R1803:Prdm16 UTSW 4 154335261 missense probably damaging 1.00
R2117:Prdm16 UTSW 4 154347925 missense probably null 0.99
R3814:Prdm16 UTSW 4 154328293 missense probably damaging 1.00
R4348:Prdm16 UTSW 4 154476667 missense probably benign 0.00
R4458:Prdm16 UTSW 4 154322308 missense probably benign
R4581:Prdm16 UTSW 4 154323353 missense probably damaging 1.00
R4584:Prdm16 UTSW 4 154337683 missense probably damaging 1.00
R4627:Prdm16 UTSW 4 154367240 missense probably damaging 1.00
R4926:Prdm16 UTSW 4 154341552 missense possibly damaging 0.74
R5055:Prdm16 UTSW 4 154335262 missense possibly damaging 0.48
R5152:Prdm16 UTSW 4 154346102 missense probably damaging 0.99
R5257:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5258:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5368:Prdm16 UTSW 4 154345391 missense probably damaging 1.00
R5464:Prdm16 UTSW 4 154346144 critical splice acceptor site probably null
R5640:Prdm16 UTSW 4 154341910 missense probably benign
R5744:Prdm16 UTSW 4 154528704 missense probably damaging 1.00
R5892:Prdm16 UTSW 4 154323259 missense possibly damaging 0.74
R5938:Prdm16 UTSW 4 154347954 missense probably damaging 0.99
R6380:Prdm16 UTSW 4 154341367 missense probably benign 0.00
R6784:Prdm16 UTSW 4 154323307 missense probably damaging 1.00
R7097:Prdm16 UTSW 4 154345468 missense probably damaging 1.00
R7181:Prdm16 UTSW 4 154528637 missense probably damaging 1.00
R7197:Prdm16 UTSW 4 154341510 missense probably damaging 1.00
R7273:Prdm16 UTSW 4 154345453 missense probably damaging 1.00
R7379:Prdm16 UTSW 4 154528859 missense probably damaging 1.00
R7641:Prdm16 UTSW 4 154345444 missense probably damaging 1.00
R7704:Prdm16 UTSW 4 154341490 missense probably damaging 1.00
R7751:Prdm16 UTSW 4 154328299 missense probably damaging 1.00
R8048:Prdm16 UTSW 4 154320882 missense probably damaging 1.00
R8225:Prdm16 UTSW 4 154355245 critical splice donor site probably null
R8503:Prdm16 UTSW 4 154341552 missense probably benign 0.04
RF008:Prdm16 UTSW 4 154341995 missense probably damaging 1.00
X0010:Prdm16 UTSW 4 154323377 missense probably damaging 1.00
Z1176:Prdm16 UTSW 4 154341786 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGTCGGCCTCCTTCAGTG -3'
(R):5'- TTGGTTCTACAAGGGCCAC -3'

Sequencing Primer
(F):5'- CACGTAGGGGCCAAACC -3'
(R):5'- GGTTCTACAAGGGCCACATCCC -3'
Posted On2015-09-24