Incidental Mutation 'R4557:Exoc1'
ID341897
Institutional Source Beutler Lab
Gene Symbol Exoc1
Ensembl Gene ENSMUSG00000036435
Gene Nameexocyst complex component 1
Synonyms2810407P21Rik, Sec3p, SEC3, A730011E05Rik, Sec3l1
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76529311-76570294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76561443 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 24 (V24M)
Ref Sequence ENSEMBL: ENSMUSP00000121784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493] [ENSMUST00000134521]
Predicted Effect probably damaging
Transcript: ENSMUST00000049469
AA Change: V611M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435
AA Change: V611M

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 856 5.5e-221 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087133
AA Change: V626M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435
AA Change: V626M

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 871 2e-220 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113493
AA Change: V633M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435
AA Change: V633M

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
coiled coil region 161 183 N/A INTRINSIC
Pfam:Sec3_C 190 878 4.1e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132807
Predicted Effect probably damaging
Transcript: ENSMUST00000134521
AA Change: V24M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121784
Gene: ENSMUSG00000036435
AA Change: V24M

DomainStartEndE-ValueType
Pfam:Sec3_C 1 111 1.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143489
Meta Mutation Damage Score 0.4100 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Exoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Exoc1 APN 5 76567023 missense possibly damaging 0.88
IGL01149:Exoc1 APN 5 76542244 splice site probably benign
IGL02061:Exoc1 APN 5 76542120 missense probably damaging 0.96
IGL02288:Exoc1 APN 5 76545313 missense probably benign
IGL02407:Exoc1 APN 5 76545346 missense probably damaging 0.97
IGL03089:Exoc1 APN 5 76542158 missense possibly damaging 0.81
IGL03242:Exoc1 APN 5 76559007 missense probably damaging 1.00
IGL03348:Exoc1 APN 5 76535593 missense probably damaging 1.00
IGL03411:Exoc1 APN 5 76542195 missense probably damaging 1.00
Smalls UTSW 5 76537779 missense probably damaging 1.00
R0462:Exoc1 UTSW 5 76543617 missense probably benign 0.37
R1216:Exoc1 UTSW 5 76554188 missense probably benign
R1528:Exoc1 UTSW 5 76549564 missense possibly damaging 0.94
R1531:Exoc1 UTSW 5 76559164 missense probably damaging 0.98
R1636:Exoc1 UTSW 5 76568118 missense probably benign 0.03
R1754:Exoc1 UTSW 5 76560322 unclassified probably null
R1803:Exoc1 UTSW 5 76561441 missense probably benign 0.18
R2086:Exoc1 UTSW 5 76532846 nonsense probably null
R2239:Exoc1 UTSW 5 76559710 unclassified probably benign
R3914:Exoc1 UTSW 5 76543561 missense possibly damaging 0.54
R4022:Exoc1 UTSW 5 76549570 missense possibly damaging 0.92
R4329:Exoc1 UTSW 5 76567975 missense probably damaging 1.00
R4413:Exoc1 UTSW 5 76542019 intron probably benign
R4427:Exoc1 UTSW 5 76563263 missense probably benign 0.00
R4627:Exoc1 UTSW 5 76542228 missense probably benign 0.26
R4677:Exoc1 UTSW 5 76559163 missense probably null 0.82
R5138:Exoc1 UTSW 5 76568075 missense probably damaging 1.00
R5325:Exoc1 UTSW 5 76537702 missense probably benign
R5342:Exoc1 UTSW 5 76567014 missense probably damaging 1.00
R5736:Exoc1 UTSW 5 76537768 missense possibly damaging 0.90
R5891:Exoc1 UTSW 5 76542144 missense probably damaging 1.00
R6102:Exoc1 UTSW 5 76537779 missense probably damaging 1.00
R6447:Exoc1 UTSW 5 76543517 missense probably damaging 0.97
R6532:Exoc1 UTSW 5 76537837 missense probably damaging 0.99
R6694:Exoc1 UTSW 5 76549552 missense probably damaging 1.00
R6753:Exoc1 UTSW 5 76563339 missense probably damaging 1.00
R6885:Exoc1 UTSW 5 76559042 missense probably damaging 1.00
R7090:Exoc1 UTSW 5 76566953 missense unknown
R7299:Exoc1 UTSW 5 76542159 missense probably damaging 1.00
R7439:Exoc1 UTSW 5 76545348 missense probably benign 0.18
R7567:Exoc1 UTSW 5 76537715 missense probably damaging 0.96
R7665:Exoc1 UTSW 5 76543573 missense probably benign 0.33
R7745:Exoc1 UTSW 5 76561512 nonsense probably null
R7883:Exoc1 UTSW 5 76561382 missense probably damaging 0.99
R7966:Exoc1 UTSW 5 76561382 missense probably damaging 0.99
X0018:Exoc1 UTSW 5 76567035 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTGCAGCACCAGTGTCTAG -3'
(R):5'- ACAGCTCTGTGCATCATGAAC -3'

Sequencing Primer
(F):5'- AGCACCAGTGTCTAGCTGTG -3'
(R):5'- TGTGCATCATGAACAGCAAGC -3'
Posted On2015-09-24