Incidental Mutation 'R4557:Thap12'
ID341902
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene NameTHAP domain containing 12
SynonymsPrkrir, Dap4, 2900052B10Rik
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location98703103-98718062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98715845 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 407 (N407D)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
Predicted Effect probably benign
Transcript: ENSMUST00000033009
AA Change: N407D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: N407D

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146473
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208543
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98716137 missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98712903 makesense probably null
IGL01973:Thap12 APN 7 98716499 missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98710133 missense probably damaging 1.00
H8562:Thap12 UTSW 7 98715107 missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98715038 missense probably benign 0.00
R0090:Thap12 UTSW 7 98715893 missense probably damaging 1.00
R0254:Thap12 UTSW 7 98715281 missense probably benign 0.03
R1344:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1384:Thap12 UTSW 7 98703438 missense probably damaging 0.98
R1418:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1448:Thap12 UTSW 7 98716023 missense probably benign 0.01
R1493:Thap12 UTSW 7 98715438 missense probably benign 0.30
R1906:Thap12 UTSW 7 98716740 missense probably damaging 1.00
R1932:Thap12 UTSW 7 98716838 missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98716365 missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98716620 missense probably damaging 1.00
R2092:Thap12 UTSW 7 98716449 missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98710126 missense probably damaging 0.97
R3850:Thap12 UTSW 7 98716663 missense probably damaging 1.00
R4086:Thap12 UTSW 7 98716494 missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98710078 intron probably benign
R4554:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4555:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4556:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4659:Thap12 UTSW 7 98710091 intron probably benign
R4734:Thap12 UTSW 7 98715954 missense probably damaging 0.98
R4734:Thap12 UTSW 7 98715955 nonsense probably null
R5794:Thap12 UTSW 7 98716393 missense probably benign 0.11
R5994:Thap12 UTSW 7 98716030 nonsense probably null
R6298:Thap12 UTSW 7 98703405 missense probably damaging 1.00
R6515:Thap12 UTSW 7 98707095 missense probably damaging 0.97
R6624:Thap12 UTSW 7 98715586 nonsense probably null
R6625:Thap12 UTSW 7 98716070 missense probably benign 0.00
R6965:Thap12 UTSW 7 98715462 missense probably damaging 1.00
R7560:Thap12 UTSW 7 98710231 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCTTACATTGTGTCCAGTGG -3'
(R):5'- GCTCGCCCAGCTATATAGTTATTCC -3'

Sequencing Primer
(F):5'- TTAGAAAAATATCCCCAGGCTGTC -3'
(R):5'- AGTTATTCCACCTAACATTTGTGTC -3'
Posted On2015-09-24