Incidental Mutation 'R4557:Med17'
ID341906
Institutional Source Beutler Lab
Gene Symbol Med17
Ensembl Gene ENSMUSG00000031935
Gene Namemediator complex subunit 17
SynonymsTrap80, C330002H14Rik, Crsp6
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15260351-15279931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15271697 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 351 (K351E)
Ref Sequence ENSEMBL: ENSMUSP00000034411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034411] [ENSMUST00000213788] [ENSMUST00000216406]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034411
AA Change: K351E

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034411
Gene: ENSMUSG00000031935
AA Change: K351E

DomainStartEndE-ValueType
low complexity region 51 82 N/A INTRINSIC
Pfam:Med17 123 452 8.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213356
Predicted Effect probably benign
Transcript: ENSMUST00000213788
Predicted Effect probably benign
Transcript: ENSMUST00000216406
Meta Mutation Damage Score 0.1610 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Med17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Med17 APN 9 15279621 missense probably benign 0.19
IGL02263:Med17 APN 9 15267476 missense probably damaging 0.98
IGL02390:Med17 APN 9 15277667 nonsense probably null
IGL02391:Med17 APN 9 15277667 nonsense probably null
IGL02392:Med17 APN 9 15277667 nonsense probably null
IGL02393:Med17 APN 9 15277667 nonsense probably null
IGL02591:Med17 APN 9 15270361 missense probably damaging 1.00
IGL02635:Med17 APN 9 15274549 missense probably damaging 1.00
IGL02745:Med17 APN 9 15265346 splice site probably benign
IGL02815:Med17 APN 9 15262267 missense probably damaging 1.00
IGL02897:Med17 APN 9 15267534 missense probably damaging 1.00
R1448:Med17 UTSW 9 15275843 splice site probably null
R2912:Med17 UTSW 9 15275914 missense probably damaging 1.00
R2937:Med17 UTSW 9 15275891 missense probably damaging 0.99
R3715:Med17 UTSW 9 15263766 splice site probably benign
R4175:Med17 UTSW 9 15267469 missense possibly damaging 0.93
R4701:Med17 UTSW 9 15270360 missense probably damaging 1.00
R4865:Med17 UTSW 9 15265372 nonsense probably null
R5169:Med17 UTSW 9 15277604 missense probably benign 0.03
R5510:Med17 UTSW 9 15270404 missense probably benign
R6326:Med17 UTSW 9 15279558 missense probably benign 0.32
R6393:Med17 UTSW 9 15274583 missense probably damaging 1.00
R6598:Med17 UTSW 9 15271700 missense probably benign 0.29
R7722:Med17 UTSW 9 15271691 missense probably benign 0.01
R8181:Med17 UTSW 9 15277632 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GTTGGTACCTCTCAGTGGAAGG -3'
(R):5'- TAACCGTTGTCCAAGCCTG -3'

Sequencing Primer
(F):5'- TCTCAGTGGAAGGCCTGCTC -3'
(R):5'- TGTCCAAGCCTGTGAGAATTG -3'
Posted On2015-09-24