Incidental Mutation 'R4557:Ccdc175'
ID341919
Institutional Source Beutler Lab
Gene Symbol Ccdc175
Ensembl Gene ENSMUSG00000021086
Gene Namecoiled-coil domain containing 175
Synonyms
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72101300-72185029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72128306 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 531 (E531V)
Ref Sequence ENSEMBL: ENSMUSP00000021494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021494]
Predicted Effect probably benign
Transcript: ENSMUST00000021494
AA Change: E531V

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021494
Gene: ENSMUSG00000021086
AA Change: E531V

DomainStartEndE-ValueType
coiled coil region 129 164 N/A INTRINSIC
coiled coil region 205 235 N/A INTRINSIC
coiled coil region 295 383 N/A INTRINSIC
low complexity region 470 490 N/A INTRINSIC
coiled coil region 517 537 N/A INTRINSIC
low complexity region 803 819 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179978
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Ccdc175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Ccdc175 APN 12 72131142 splice site probably benign
IGL01805:Ccdc175 APN 12 72129229 splice site probably benign
IGL01807:Ccdc175 APN 12 72159842 missense probably benign 0.02
IGL01985:Ccdc175 APN 12 72128278 nonsense probably null
IGL02719:Ccdc175 APN 12 72175125 missense probably damaging 0.97
IGL02944:Ccdc175 APN 12 72117893 missense probably benign 0.02
IGL03113:Ccdc175 APN 12 72144783 missense probably benign 0.00
IGL03143:Ccdc175 APN 12 72136058 missense probably benign 0.03
IGL03356:Ccdc175 APN 12 72139893 splice site probably null
R0009:Ccdc175 UTSW 12 72135965 missense possibly damaging 0.87
R0233:Ccdc175 UTSW 12 72105876 missense probably benign 0.00
R0233:Ccdc175 UTSW 12 72105876 missense probably benign 0.00
R0609:Ccdc175 UTSW 12 72157507 missense probably benign 0.07
R0706:Ccdc175 UTSW 12 72139948 missense probably benign 0.04
R0948:Ccdc175 UTSW 12 72131123 missense probably damaging 1.00
R1054:Ccdc175 UTSW 12 72178544 missense possibly damaging 0.85
R1166:Ccdc175 UTSW 12 72105932 missense probably damaging 1.00
R1481:Ccdc175 UTSW 12 72101948 unclassified probably benign
R1860:Ccdc175 UTSW 12 72105926 missense probably benign
R2077:Ccdc175 UTSW 12 72140020 missense possibly damaging 0.54
R3806:Ccdc175 UTSW 12 72180824 missense possibly damaging 0.72
R3879:Ccdc175 UTSW 12 72136018 missense probably damaging 1.00
R3887:Ccdc175 UTSW 12 72136048 missense possibly damaging 0.65
R4585:Ccdc175 UTSW 12 72175179 missense possibly damaging 0.65
R4686:Ccdc175 UTSW 12 72112278 missense probably damaging 1.00
R4766:Ccdc175 UTSW 12 72112205 missense probably benign 0.00
R4773:Ccdc175 UTSW 12 72136048 missense probably damaging 0.99
R4909:Ccdc175 UTSW 12 72159753 missense probably damaging 1.00
R4964:Ccdc175 UTSW 12 72180845 missense probably damaging 1.00
R5338:Ccdc175 UTSW 12 72184971 missense probably damaging 0.99
R5539:Ccdc175 UTSW 12 72144813 missense probably benign 0.00
R5897:Ccdc175 UTSW 12 72159804 missense probably benign 0.06
R6128:Ccdc175 UTSW 12 72129159 missense probably benign 0.07
R6520:Ccdc175 UTSW 12 72140030 missense probably damaging 0.98
R6523:Ccdc175 UTSW 12 72144791 missense probably benign 0.01
R6917:Ccdc175 UTSW 12 72184905 missense probably damaging 1.00
R7035:Ccdc175 UTSW 12 72155645 missense probably benign 0.01
R7097:Ccdc175 UTSW 12 72128409 splice site probably null
R7339:Ccdc175 UTSW 12 72136041 missense probably damaging 1.00
R7450:Ccdc175 UTSW 12 72155673 missense possibly damaging 0.93
R7481:Ccdc175 UTSW 12 72155624 missense probably benign 0.00
R7676:Ccdc175 UTSW 12 72102047 missense possibly damaging 0.57
R8045:Ccdc175 UTSW 12 72155902 intron probably benign
R8383:Ccdc175 UTSW 12 72109178 missense possibly damaging 0.95
R8470:Ccdc175 UTSW 12 72155618 missense probably damaging 0.97
Z1088:Ccdc175 UTSW 12 72128379 missense probably benign 0.01
Z1176:Ccdc175 UTSW 12 72112308 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAACGGACTGTGGTCTTGC -3'
(R):5'- TTGGTGGGCAACAAAGCAC -3'

Sequencing Primer
(F):5'- TTGCCTTGGCTCATACCGGAAG -3'
(R):5'- TGCTGAGACATCCCACAGTTTATCAG -3'
Posted On2015-09-24