Incidental Mutation 'R4557:Mcrs1'
ID341924
Institutional Source Beutler Lab
Gene Symbol Mcrs1
Ensembl Gene ENSMUSG00000037570
Gene Namemicrospherule protein 1
SynonymsP78, MSP58, ICP22BP, C78274
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4557 (G1)
Quality Score219
Status Validated
Chromosome15
Chromosomal Location99242817-99251961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99243147 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 459 (I459T)
Ref Sequence ENSEMBL: ENSMUSP00000043901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041190] [ENSMUST00000041415] [ENSMUST00000163506]
Predicted Effect probably benign
Transcript: ENSMUST00000041190
AA Change: I459T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000043901
Gene: ENSMUSG00000037570
AA Change: I459T

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 81 113 N/A INTRINSIC
Pfam:MCRS_N 134 331 5.7e-98 PFAM
FHA 362 419 2.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041415
SMART Domains Protein: ENSMUSP00000040548
Gene: ENSMUSG00000037579

DomainStartEndE-ValueType
PAS 20 88 3.94e0 SMART
PAC 94 136 9.92e-6 SMART
low complexity region 148 159 N/A INTRINSIC
Pfam:Ion_trans 224 523 3.8e-34 PFAM
Pfam:Ion_trans_2 453 517 1e-12 PFAM
cNMP 593 708 2.04e-16 SMART
low complexity region 781 800 N/A INTRINSIC
low complexity region 857 872 N/A INTRINSIC
coiled coil region 886 918 N/A INTRINSIC
low complexity region 977 993 N/A INTRINSIC
low complexity region 1022 1035 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163506
AA Change: I446T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131407
Gene: ENSMUSG00000037570
AA Change: I446T

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 68 100 N/A INTRINSIC
Pfam:MCRS_N 121 318 2.4e-97 PFAM
FHA 349 406 2.04e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229143
Predicted Effect probably benign
Transcript: ENSMUST00000229399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231020
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Mcrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Mcrs1 APN 15 99243385 missense probably damaging 0.97
IGL01338:Mcrs1 APN 15 99249501 missense probably damaging 1.00
IGL01975:Mcrs1 APN 15 99243678 critical splice donor site probably null
PIT4651001:Mcrs1 UTSW 15 99246951 missense probably damaging 1.00
R0125:Mcrs1 UTSW 15 99244727 unclassified probably benign
R0520:Mcrs1 UTSW 15 99248455 splice site probably null
R0744:Mcrs1 UTSW 15 99243449 unclassified probably benign
R0833:Mcrs1 UTSW 15 99243449 unclassified probably benign
R0836:Mcrs1 UTSW 15 99243449 unclassified probably benign
R2099:Mcrs1 UTSW 15 99249946 missense probably benign 0.00
R2133:Mcrs1 UTSW 15 99243375 missense probably damaging 1.00
R5425:Mcrs1 UTSW 15 99243688 missense probably damaging 1.00
R5517:Mcrs1 UTSW 15 99246995 missense possibly damaging 0.88
R7129:Mcrs1 UTSW 15 99248728 missense probably damaging 1.00
R8012:Mcrs1 UTSW 15 99249885 missense probably damaging 1.00
R8015:Mcrs1 UTSW 15 99248854 nonsense probably null
R8025:Mcrs1 UTSW 15 99246933 nonsense probably null
R8171:Mcrs1 UTSW 15 99248732 missense probably damaging 1.00
R8191:Mcrs1 UTSW 15 99243325 missense probably damaging 1.00
R8420:Mcrs1 UTSW 15 99243694 missense probably damaging 1.00
R8486:Mcrs1 UTSW 15 99248468 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTCACTGGAGACACAGGAG -3'
(R):5'- GCGCCTTAGCAACAACTCTG -3'

Sequencing Primer
(F):5'- TGGCTTCCCCATGGTGAC -3'
(R):5'- GCCTTAGCAACAACTCTGTGGTAG -3'
Posted On2015-09-24