Incidental Mutation 'R4557:Olfr761'
ID341927
Institutional Source Beutler Lab
Gene Symbol Olfr761
Ensembl Gene ENSMUSG00000109376
Gene Nameolfactory receptor 761
SynonymsMOR218-5P, MOR218-6P, MOR218-12, Olfr1552-ps1, GA_x6K02T2PSCP-2403971-2403000, MOR218-6P
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37952051-37953079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37952251 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 258 (A258S)
Ref Sequence ENSEMBL: ENSMUSP00000092917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049620]
Predicted Effect probably benign
Transcript: ENSMUST00000049620
AA Change: A258S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092917
Gene: ENSMUSG00000109376
AA Change: A258S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 3.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172723
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Olfr761
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Olfr761 APN 17 37952851 missense probably damaging 1.00
IGL02104:Olfr761 APN 17 37952291 missense probably damaging 1.00
IGL02431:Olfr761 APN 17 37952522 missense probably benign 0.06
IGL02649:Olfr761 APN 17 37952973 missense probably damaging 1.00
IGL03109:Olfr761 APN 17 37952487 missense probably damaging 1.00
IGL03261:Olfr761 APN 17 37952806 missense possibly damaging 0.76
R0898:Olfr761 UTSW 17 37952236 missense probably benign 0.17
R1373:Olfr761 UTSW 17 37952360 missense probably damaging 1.00
R1527:Olfr761 UTSW 17 37952829 missense possibly damaging 0.88
R1664:Olfr761 UTSW 17 37952893 missense probably benign 0.44
R1835:Olfr761 UTSW 17 37952385 missense possibly damaging 0.79
R4124:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4125:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4128:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4534:Olfr761 UTSW 17 37952722 missense probably benign
R4790:Olfr761 UTSW 17 37952742 missense probably damaging 0.99
R4856:Olfr761 UTSW 17 37952071 missense probably benign 0.15
R4886:Olfr761 UTSW 17 37952071 missense probably benign 0.15
R4955:Olfr761 UTSW 17 37952898 missense probably damaging 1.00
R5162:Olfr761 UTSW 17 37952364 missense probably benign 0.00
R6016:Olfr761 UTSW 17 37952076 missense probably benign 0.13
R6282:Olfr761 UTSW 17 37952424 missense possibly damaging 0.80
R7018:Olfr761 UTSW 17 37952502 missense probably damaging 1.00
R7199:Olfr761 UTSW 17 37952157 missense probably damaging 1.00
R7340:Olfr761 UTSW 17 37952522 missense probably benign 0.06
R7360:Olfr761 UTSW 17 37953009 missense probably damaging 1.00
R7464:Olfr761 UTSW 17 37952280 missense probably damaging 1.00
R7974:Olfr761 UTSW 17 37952781 missense probably damaging 1.00
X0064:Olfr761 UTSW 17 37952814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCCAGTGTTAGCAGGCAC -3'
(R):5'- TCCTGCTCTAATGATGACTTTGG -3'

Sequencing Primer
(F):5'- TCCAGTGTTAGCAGGCACTAAAAAC -3'
(R):5'- CTGCTCTAATGATGACTTTGGAGTAC -3'
Posted On2015-09-24