Mutagenetix > Incidental Mutations

Incidental Mutation 'R4557:Pitpnm1'

341930

Institutional Source

Beutler Lab

Gene Symbol

Pitpnm1

Ensembl Gene

ENSMUSG00000024851

Gene Name

phosphatidylinositol transfer protein, membrane-associated 1

Synonyms

DRES9, RdgB

MMRRC Submission

041784-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4557 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4099998-4113965 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4103085 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 135 (Q135R)

Ref Sequence

ENSEMBL: ENSMUSP00000097599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025779] [ENSMUST00000049658] [ENSMUST00000100022] [ENSMUST00000131265] [ENSMUST00000174149] [ENSMUST00000174514] [ENSMUST00000174799]

Predicted Effect

probably benign
Transcript: ENSMUST00000025779

SMART Domains

Protein: ENSMUSP00000025779
Gene: ENSMUSG00000024856

Domain	Start	End	E-Value	Type
low complexity region	7	44	N/A	INTRINSIC
Pfam:CDK2AP	58	126	1.4e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000049658
AA Change: Q135R

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000054309
Gene: ENSMUSG00000024851
AA Change: Q135R

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	252	2e-145	PFAM
low complexity region	284	304	N/A	INTRINSIC
low complexity region	310	319	N/A	INTRINSIC
low complexity region	342	349	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	557	571	N/A	INTRINSIC
low complexity region	578	593	N/A	INTRINSIC
DDHD	685	879	5.94e-86	SMART
Blast:DDHD	880	963	2e-42	BLAST
LNS2	1022	1153	1.35e-57	SMART
low complexity region	1184	1195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100022
AA Change: Q135R

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000097599
Gene: ENSMUSG00000024851
AA Change: Q135R

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	250	1.6e-113	PFAM
low complexity region	284	304	N/A	INTRINSIC
low complexity region	310	319	N/A	INTRINSIC
low complexity region	342	349	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	557	571	N/A	INTRINSIC
low complexity region	578	593	N/A	INTRINSIC
DDHD	685	879	5.94e-86	SMART
Blast:DDHD	880	963	2e-42	BLAST
LNS2	1022	1153	1.35e-57	SMART
low complexity region	1184	1195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131265
AA Change: Q135R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000120563
Gene: ENSMUSG00000024851
AA Change: Q135R

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	252	5e-147	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151957

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172914

Predicted Effect

probably benign
Transcript: ENSMUST00000174149

SMART Domains

Protein: ENSMUSP00000134613
Gene: ENSMUSG00000024856

Domain	Start	End	E-Value	Type
low complexity region	7	44	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174514

SMART Domains

Protein: ENSMUSP00000134093
Gene: ENSMUSG00000024856

Domain	Start	End	E-Value	Type
Pfam:CDK2AP	30	107	8.1e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174799

SMART Domains

Protein: ENSMUSP00000133593
Gene: ENSMUSG00000024856

Domain	Start	End	E-Value	Type
low complexity region	7	44	N/A	INTRINSIC

Meta Mutation Damage Score

0.1227

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM1 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male-specific decrease in circulating cholesterol and circulating calcium levels and female-specific decreased leukocyte cell numbers and a slight increase in auditory brainstem response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830005F24Rik	T	C	13: 48,514,461		probably benign	Het
Acad11	T	C	9: 104,082,839	F219L	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Adamts17	A	T	7: 67,027,893	E518D	probably damaging	Het
Adamts3	A	G	5: 89,700,487	Y659H	probably benign	Het
Adgrb3	T	C	1: 25,084,279	R1414G	probably damaging	Het
Apba1	T	A	19: 23,917,592	I464N	probably damaging	Het
Bahcc1	A	G	11: 120,275,088	T1057A	probably damaging	Het
Bcl11a	A	G	11: 24,164,004	E449G	probably damaging	Het
Ccdc162	T	A	10: 41,587,388	I1453L	probably benign	Het
Ccdc175	T	A	12: 72,128,306	E531V	probably benign	Het
Cep68	A	T	11: 20,239,113		probably benign	Het
Dlgap1	C	A	17: 70,516,689	T223K	probably benign	Het
Exoc1	G	A	5: 76,561,443	V24M	probably damaging	Het
Fbxo4	A	G	15: 3,965,705	*386R	probably null	Het
Gm10100	G	A	10: 77,726,531		probably benign	Het
Gpr149	A	G	3: 62,530,870	V622A	probably damaging	Het
Gpr149	A	C	3: 62,604,497	M27R	probably benign	Het
Ighv3-6	T	C	12: 114,288,198	N101D	probably benign	Het
Igkv4-78	A	G	6: 69,059,771	S93P	possibly damaging	Het
Kmt2c	A	T	5: 25,300,315	W3332R	probably damaging	Het
Marf1	T	C	16: 14,153,977		probably benign	Het
Mcrs1	A	G	15: 99,243,147	I459T	probably benign	Het
Mdn1	G	T	4: 32,754,437	C4646F	probably damaging	Het
Med17	T	C	9: 15,271,697	K351E	possibly damaging	Het
Nalcn	T	C	14: 123,321,235		probably benign	Het
Olfr389	G	A	11: 73,776,481	T282I	possibly damaging	Het
Olfr398	A	T	11: 73,984,599	V3E	probably benign	Het
Olfr761	C	A	17: 37,952,251	A258S	probably benign	Het
Olfr816	A	G	10: 129,911,529	Y250H	probably damaging	Het
Phrf1	C	T	7: 141,258,929		probably benign	Het
Prdm16	T	A	4: 154,528,827	M48L	probably benign	Het
Ptpn13	A	G	5: 103,541,110	E923G	probably damaging	Het
Rp1	A	T	1: 4,344,663	S2075R	possibly damaging	Het
Sft2d2	A	G	1: 165,183,984	C114R	probably damaging	Het
Sipa1l2	T	G	8: 125,464,415	R945S	probably damaging	Het
Slc12a1	A	G	2: 125,186,641	N517S	probably damaging	Het
Slc44a2	T	G	9: 21,346,783	L443R	possibly damaging	Het
Smok4a	T	C	17: 13,526,381		noncoding transcript	Het
Snx18	A	G	13: 113,617,828	S190P	probably damaging	Het
Thap12	A	G	7: 98,715,845	N407D	probably benign	Het
Tmc5	T	C	7: 118,670,733	I902T	probably benign	Het
Ttc27	T	G	17: 74,829,549	S584A	probably benign	Het
Ttn	A	T	2: 76,949,015	Y1174N	probably damaging	Het
Zbtb44	T	G	9: 31,064,248	S391R	probably damaging	Het

Other mutations in Pitpnm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00886:Pitpnm1	APN	19	4110665	splice site	probably null
IGL00978:Pitpnm1	APN	19	4101228	missense	possibly damaging	0.61
IGL02039:Pitpnm1	APN	19	4105032	missense	probably benign	0.01
IGL02122:Pitpnm1	APN	19	4107796	missense	probably damaging	1.00
IGL02279:Pitpnm1	APN	19	4101207	missense	probably damaging	1.00
IGL02316:Pitpnm1	APN	19	4112835	missense	probably benign	0.16
IGL02434:Pitpnm1	APN	19	4103377	missense	probably benign	0.00
R0926:Pitpnm1	UTSW	19	4112338	missense	probably damaging	1.00
R1301:Pitpnm1	UTSW	19	4110831	splice site	probably null
R1423:Pitpnm1	UTSW	19	4112392	missense	probably damaging	1.00
R1592:Pitpnm1	UTSW	19	4106964	critical splice donor site	probably null
R1733:Pitpnm1	UTSW	19	4109960	nonsense	probably null
R1844:Pitpnm1	UTSW	19	4112395	missense	probably damaging	1.00
R1971:Pitpnm1	UTSW	19	4112450	missense	probably damaging	1.00
R1978:Pitpnm1	UTSW	19	4107973	splice site	probably null
R2016:Pitpnm1	UTSW	19	4111873	missense	probably benign	0.25
R2017:Pitpnm1	UTSW	19	4111873	missense	probably benign	0.25
R2019:Pitpnm1	UTSW	19	4113641	missense	probably damaging	1.00
R2210:Pitpnm1	UTSW	19	4105253	missense	probably damaging	1.00
R2393:Pitpnm1	UTSW	19	4110935	missense	probably benign	0.02
R3434:Pitpnm1	UTSW	19	4112234	missense	probably damaging	1.00
R3439:Pitpnm1	UTSW	19	4112752	missense	probably benign	0.00
R4554:Pitpnm1	UTSW	19	4103085	missense	probably benign	0.16
R4555:Pitpnm1	UTSW	19	4103085	missense	probably benign	0.16
R4831:Pitpnm1	UTSW	19	4108130	missense	probably damaging	1.00
R4874:Pitpnm1	UTSW	19	4112252	critical splice donor site	probably null
R5058:Pitpnm1	UTSW	19	4112758	missense	probably benign	0.00
R5069:Pitpnm1	UTSW	19	4111140	missense	probably benign	0.44
R5249:Pitpnm1	UTSW	19	4108130	missense	probably damaging	1.00
R5288:Pitpnm1	UTSW	19	4103435	missense	probably damaging	0.99
R5385:Pitpnm1	UTSW	19	4103435	missense	probably damaging	0.99
R5619:Pitpnm1	UTSW	19	4103270	missense	probably damaging	1.00
R5650:Pitpnm1	UTSW	19	4103319	missense	possibly damaging	0.78
R6267:Pitpnm1	UTSW	19	4110522	missense	probably damaging	1.00
R6341:Pitpnm1	UTSW	19	4102829	nonsense	probably null
R6608:Pitpnm1	UTSW	19	4110875	missense	probably damaging	1.00
R6739:Pitpnm1	UTSW	19	4110522	missense	probably damaging	1.00
R6915:Pitpnm1	UTSW	19	4106947	missense	possibly damaging	0.95
R7141:Pitpnm1	UTSW	19	4102787	missense	probably damaging	0.97
R7751:Pitpnm1	UTSW	19	4103470	missense	probably benign	0.02
R8057:Pitpnm1	UTSW	19	4112145	missense	probably null	0.71
R8210:Pitpnm1	UTSW	19	4112878	critical splice donor site	probably null
R8415:Pitpnm1	UTSW	19	4105454	missense	probably benign	0.37
R8462:Pitpnm1	UTSW	19	4105135	missense	probably benign	0.03
Z1177:Pitpnm1	UTSW	19	4105009	missense	probably benign
Z1177:Pitpnm1	UTSW	19	4109996	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGAACGCTTACCCATATACC -3'
(R):5'- GAAGGGGTTTCAGTCAGCAC -3'

Sequencing Primer
(F):5'- TGTGAGACAGGCACAGGCTC -3'
(R):5'- GGGTTTCAGTCAGCACTAAGC -3'

Posted On

2015-09-24