Incidental Mutation 'R4557:Apba1'
ID341931
Institutional Source Beutler Lab
Gene Symbol Apba1
Ensembl Gene ENSMUSG00000024897
Gene Nameamyloid beta (A4) precursor protein binding, family A, member 1
Synonyms6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23758876-23949597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23917592 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 464 (I464N)
Ref Sequence ENSEMBL: ENSMUSP00000025830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025830]
Predicted Effect probably damaging
Transcript: ENSMUST00000025830
AA Change: I464N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: I464N

DomainStartEndE-ValueType
low complexity region 40 47 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 404 421 N/A INTRINSIC
PTB 461 626 9.49e-33 SMART
PDZ 670 748 3.09e-15 SMART
PDZ 762 828 2.53e-11 SMART
Meta Mutation Damage Score 0.5364 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Apba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Apba1 APN 19 23917586 missense possibly damaging 0.95
IGL01991:Apba1 APN 19 23937472 missense possibly damaging 0.80
IGL02048:Apba1 APN 19 23937636 splice site probably null
IGL02522:Apba1 APN 19 23912445 splice site probably benign
IGL02728:Apba1 APN 19 23944905 missense possibly damaging 0.93
IGL02942:Apba1 APN 19 23944971 missense possibly damaging 0.78
IGL03349:Apba1 APN 19 23917575 missense probably benign 0.02
IGL03410:Apba1 APN 19 23937581 missense possibly damaging 0.67
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0084:Apba1 UTSW 19 23912497 missense possibly damaging 0.68
R0379:Apba1 UTSW 19 23934830 missense probably damaging 1.00
R0423:Apba1 UTSW 19 23944998 missense probably damaging 1.00
R1132:Apba1 UTSW 19 23917553 missense possibly damaging 0.83
R1291:Apba1 UTSW 19 23917672 missense probably damaging 0.97
R1681:Apba1 UTSW 19 23936561 missense probably damaging 1.00
R1714:Apba1 UTSW 19 23944952 missense possibly damaging 0.67
R1756:Apba1 UTSW 19 23893692 missense possibly damaging 0.83
R1866:Apba1 UTSW 19 23892831 missense probably benign 0.22
R2076:Apba1 UTSW 19 23893223 nonsense probably null
R2217:Apba1 UTSW 19 23893962 missense probably damaging 0.99
R3907:Apba1 UTSW 19 23937506 missense probably damaging 0.96
R4095:Apba1 UTSW 19 23944024 missense probably benign 0.00
R4529:Apba1 UTSW 19 23936535 missense probably damaging 1.00
R4972:Apba1 UTSW 19 23912536 missense probably benign 0.24
R5521:Apba1 UTSW 19 23893593 missense probably damaging 1.00
R6539:Apba1 UTSW 19 23936560 missense probably damaging 1.00
R7032:Apba1 UTSW 19 23912461 missense probably benign 0.20
R7035:Apba1 UTSW 19 23917567 missense possibly damaging 0.88
R7495:Apba1 UTSW 19 23936599 critical splice donor site probably null
Z1176:Apba1 UTSW 19 23944115 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTACAGGTCTGGCTAAGAGAC -3'
(R):5'- AAGAGCTGTGGGTTGACACTG -3'

Sequencing Primer
(F):5'- TTTTTACGATTGGGCTCTGATTC -3'
(R):5'- GTTGACACTGCCTGCTCAG -3'
Posted On2015-09-24