Incidental Mutation 'R4568:Olfr1411'
ID341933
Institutional Source Beutler Lab
Gene Symbol Olfr1411
Ensembl Gene ENSMUSG00000062497
Gene Nameolfactory receptor 1411
SynonymsGA_x6K02T2R7CC-81157497-81156526, MOR208-3
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92594411-92597753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92597391 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 291 (M291L)
Ref Sequence ENSEMBL: ENSMUSP00000150254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073748] [ENSMUST00000190844] [ENSMUST00000216444]
Predicted Effect probably benign
Transcript: ENSMUST00000073748
AA Change: M291L

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073422
Gene: ENSMUSG00000062497
AA Change: M291L

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:7tm_4 38 314 7.4e-53 PFAM
Pfam:7tm_1 48 297 1.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190844
AA Change: M291L

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140373
Gene: ENSMUSG00000062497
AA Change: M291L

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 32 44 N/A INTRINSIC
Pfam:7tm_1 48 297 6.7e-25 PFAM
Pfam:7tm_4 146 290 2.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203299
Predicted Effect probably benign
Transcript: ENSMUST00000216444
AA Change: M291L

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Olfr1411
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Olfr1411 APN 1 92597200 missense possibly damaging 0.46
IGL02011:Olfr1411 APN 1 92596899 missense probably damaging 1.00
PIT4810001:Olfr1411 UTSW 1 92597154 missense probably benign 0.04
R2036:Olfr1411 UTSW 1 92596606 missense probably benign 0.19
R2044:Olfr1411 UTSW 1 92596969 missense probably benign 0.00
R4133:Olfr1411 UTSW 1 92596743 missense probably benign 0.09
R4406:Olfr1411 UTSW 1 92597314 missense possibly damaging 0.90
R4701:Olfr1411 UTSW 1 92597438 missense probably benign 0.00
R4801:Olfr1411 UTSW 1 92596998 missense probably benign 0.01
R4802:Olfr1411 UTSW 1 92596998 missense probably benign 0.01
R6564:Olfr1411 UTSW 1 92596563 missense probably benign
R7082:Olfr1411 UTSW 1 92596418 start gained probably benign
R7349:Olfr1411 UTSW 1 92597182 missense possibly damaging 0.95
R7589:Olfr1411 UTSW 1 92597059 missense probably benign 0.00
Z1177:Olfr1411 UTSW 1 92597266 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTCTCAGGATGCACTCGGG -3'
(R):5'- GATGGTTACATGGACTAAACAATGG -3'

Sequencing Primer
(F):5'- GATCTGGGAGGCACAAGGTCTTC -3'
(R):5'- TACATGGACTAAACAATGGAGGAAAG -3'
Posted On2015-09-24