Mutagenetix > Incidental Mutations

Incidental Mutation 'R4568:Ptpn4'

341934

Institutional Source

Beutler Lab

Gene Symbol

Ptpn4

Ensembl Gene

ENSMUSG00000026384

Gene Name

protein tyrosine phosphatase, non-receptor type 4

Synonyms

TEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)

MMRRC Submission

041792-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R4568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119652467-119837613 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119680059 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 757 (E757G)

Ref Sequence

ENSEMBL: ENSMUSP00000067614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000166624]

Predicted Effect

probably damaging
Transcript: ENSMUST00000064091
AA Change: E757G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: E757G

Domain	Start	End	E-Value	Type
B41	25	222	7.33e-80	SMART
FERM_C	226	316	6.48e-34	SMART
FA	322	368	3.28e-12	SMART
PDZ	526	605	2.47e-14	SMART
PTPc	654	913	1.38e-120	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166624

SMART Domains

Protein: ENSMUSP00000126216
Gene: ENSMUSG00000026384

Domain	Start	End	E-Value	Type
Blast:PTPc	1	65	1e-34	BLAST
PDB:2I75\|A	15	67	2e-28	PDB

Meta Mutation Damage Score

0.9349

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,563,517	W5R	probably benign	Het
Bik	T	C	15: 83,541,444		probably null	Het
Col6a1	A	T	10: 76,719,197		probably benign	Het
Crem	A	G	18: 3,299,175	I83T	probably damaging	Het
Csn1s1	G	A	5: 87,680,904	V276I	possibly damaging	Het
Ctnna3	C	T	10: 63,852,809	T344M	possibly damaging	Het
Dgcr8	G	A	16: 18,280,394	P378S	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fam208a	A	T	14: 27,476,701		probably null	Het
Gpr139	C	T	7: 119,144,805	V186M	probably damaging	Het
Krba1	A	G	6: 48,409,723	T422A	probably damaging	Het
Lgals8	T	G	13: 12,453,373	Y125S	probably damaging	Het
Map4k1	G	A	7: 28,986,654	G107D	probably damaging	Het
Mfsd6	A	T	1: 52,663,289	Y599*	probably null	Het
Olfr1411	A	T	1: 92,597,391	M291L	probably benign	Het
Olfr412	A	G	11: 74,365,209	E180G	probably damaging	Het
Omt2b	T	A	9: 78,328,247		probably benign	Het
Pga5	A	G	19: 10,671,852	Y235H	probably damaging	Het
Phldb2	T	A	16: 45,777,718	K869*	probably null	Het
Pik3cb	T	C	9: 99,090,302	M268V	probably benign	Het
Pla2g4a	T	C	1: 149,842,226	D624G	probably benign	Het
Plxna4	T	A	6: 32,152,938	I1817F	probably damaging	Het
Psmg3	A	G	5: 139,826,249	I32T	probably damaging	Het
Rasl2-9	AGG	A	7: 5,125,375		probably null	Het
Ripply3	T	A	16: 94,335,829	D116E	probably damaging	Het
Robo4	T	C	9: 37,404,822	V263A	possibly damaging	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Spef2	T	C	15: 9,647,217	H1008R	probably damaging	Het
Stag1	T	C	9: 100,848,669	V379A	probably damaging	Het
Tbc1d9	A	G	8: 83,271,177	E1121G	probably benign	Het
Tpr	T	C	1: 150,392,959		probably benign	Het
Trpv6	G	T	6: 41,626,569	P206H	probably damaging	Het
Vmn2r63	T	C	7: 42,933,826		probably null	Het
Vmn2r65	C	T	7: 84,947,469	C126Y	probably damaging	Het

Other mutations in Ptpn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Ptpn4	APN	1	119659925	splice site	probably benign
IGL00885:Ptpn4	APN	1	119802363	missense	possibly damaging	0.95
IGL00973:Ptpn4	APN	1	119741371	missense	probably benign	0.00
IGL01867:Ptpn4	APN	1	119675599	missense	probably benign
IGL01870:Ptpn4	APN	1	119675547	critical splice donor site	probably null
IGL02101:Ptpn4	APN	1	119687678	missense	probably damaging	1.00
IGL02344:Ptpn4	APN	1	119773260	missense	probably damaging	1.00
IGL02348:Ptpn4	APN	1	119682722	missense	probably damaging	1.00
IGL02693:Ptpn4	APN	1	119715969	missense	probably damaging	0.96
IGL03281:Ptpn4	APN	1	119659912	missense	probably damaging	1.00
alto	UTSW	1	119684581	nonsense	probably null
botched	UTSW	1	119743390	missense	probably damaging	1.00
bungled	UTSW	1	119687605	splice site	probably null
hash	UTSW	1	119765919	nonsense	probably null
Hoechter	UTSW	1	119680059	missense	probably damaging	1.00
BB008:Ptpn4	UTSW	1	119680195	missense	probably damaging	0.98
BB018:Ptpn4	UTSW	1	119680195	missense	probably damaging	0.98
R0105:Ptpn4	UTSW	1	119687605	splice site	probably null
R0105:Ptpn4	UTSW	1	119687605	splice site	probably null
R0504:Ptpn4	UTSW	1	119765915	missense	probably damaging	1.00
R1148:Ptpn4	UTSW	1	119684540	missense	probably damaging	0.99
R1148:Ptpn4	UTSW	1	119675709	splice site	probably benign
R1148:Ptpn4	UTSW	1	119684540	missense	probably damaging	0.99
R1662:Ptpn4	UTSW	1	119765058	missense	probably damaging	0.96
R1694:Ptpn4	UTSW	1	119783510	missense	probably damaging	0.99
R1733:Ptpn4	UTSW	1	119716043	splice site	probably null
R2083:Ptpn4	UTSW	1	119687759	missense	possibly damaging	0.63
R2226:Ptpn4	UTSW	1	119682785	missense	probably damaging	1.00
R2276:Ptpn4	UTSW	1	119684591	missense	probably damaging	1.00
R2277:Ptpn4	UTSW	1	119684591	missense	probably damaging	1.00
R3123:Ptpn4	UTSW	1	119765423	splice site	probably null
R3425:Ptpn4	UTSW	1	119707830	missense	probably benign	0.02
R4716:Ptpn4	UTSW	1	119721868	missense	probably damaging	1.00
R4819:Ptpn4	UTSW	1	119659850	missense	probably benign
R4959:Ptpn4	UTSW	1	119765096	nonsense	probably null
R5161:Ptpn4	UTSW	1	119707863	nonsense	probably null
R5345:Ptpn4	UTSW	1	119765477	missense	probably benign
R5471:Ptpn4	UTSW	1	119765919	nonsense	probably null
R5826:Ptpn4	UTSW	1	119684516	missense	probably benign	0.32
R5933:Ptpn4	UTSW	1	119687723	missense	probably damaging	0.97
R6075:Ptpn4	UTSW	1	119765136	missense	probably damaging	1.00
R6286:Ptpn4	UTSW	1	119721862	critical splice donor site	probably null
R6389:Ptpn4	UTSW	1	119721954	missense	probably damaging	0.97
R6392:Ptpn4	UTSW	1	119773123	missense	probably benign
R6769:Ptpn4	UTSW	1	119715968	missense	probably benign	0.01
R6771:Ptpn4	UTSW	1	119715968	missense	probably benign	0.01
R6794:Ptpn4	UTSW	1	119743390	missense	probably damaging	1.00
R6933:Ptpn4	UTSW	1	119773148	intron	probably benign
R6967:Ptpn4	UTSW	1	119684581	nonsense	probably null
R6980:Ptpn4	UTSW	1	119743421	missense	possibly damaging	0.86
R7150:Ptpn4	UTSW	1	119691745	critical splice donor site	probably null
R7247:Ptpn4	UTSW	1	119690034	makesense	probably null
R7283:Ptpn4	UTSW	1	119682531	missense	possibly damaging	0.90
R7459:Ptpn4	UTSW	1	119659834	missense	probably damaging	0.99
R7732:Ptpn4	UTSW	1	119692802	missense	probably benign
R7794:Ptpn4	UTSW	1	119726037	missense	probably damaging	1.00
R8061:Ptpn4	UTSW	1	119691600	critical splice donor site	probably null
R8236:Ptpn4	UTSW	1	119678822	missense	possibly damaging	0.81
RF014:Ptpn4	UTSW	1	119684465	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGTTGCTAGTATTGTGCTGATCAC -3'
(R):5'- ACTTTGGACATTGCCAGGAAATTT -3'

Sequencing Primer
(F):5'- GCTGATCACAGTCTTAAGTATTTAGC -3'
(R):5'- GGACATTGCCAGGAAATTTCTTTTAC -3'

Posted On

2015-09-24