Incidental Mutation 'R4568:Krba1'
ID341941
Institutional Source Beutler Lab
Gene Symbol Krba1
Ensembl Gene ENSMUSG00000042810
Gene NameKRAB-A domain containing 1
SynonymsA930040G15Rik
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48395586-48419781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48409723 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 422 (T422A)
Ref Sequence ENSEMBL: ENSMUSP00000031815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031815] [ENSMUST00000077093] [ENSMUST00000114571] [ENSMUST00000114572] [ENSMUST00000203371]
Predicted Effect probably damaging
Transcript: ENSMUST00000031815
AA Change: T422A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031815
Gene: ENSMUSG00000042810
AA Change: T422A

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
KRBA1 154 197 1.27e-3 SMART
KRBA1 249 291 3.23e-14 SMART
KRBA1 310 355 8.27e-12 SMART
KRBA1 357 399 4.98e-6 SMART
low complexity region 452 459 N/A INTRINSIC
KRBA1 474 516 6.03e-14 SMART
KRBA1 576 619 7.71e-12 SMART
coiled coil region 814 847 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077093
AA Change: T433A

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076345
Gene: ENSMUSG00000042810
AA Change: T433A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 193 235 3.23e-14 SMART
KRBA1 254 299 8.27e-12 SMART
KRBA1 367 409 7.26e-8 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 6.03e-14 SMART
KRBA1 586 629 7.71e-12 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114571
AA Change: T433A

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110218
Gene: ENSMUSG00000042810
AA Change: T433A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 193 235 3.23e-14 SMART
KRBA1 254 299 8.27e-12 SMART
KRBA1 367 409 7.26e-8 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 6.03e-14 SMART
KRBA1 586 629 7.71e-12 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114572
AA Change: T468A

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110219
Gene: ENSMUSG00000042810
AA Change: T468A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 194 236 3.23e-14 SMART
KRBA1 255 300 8.27e-12 SMART
KRBA1 368 410 7.26e-8 SMART
low complexity region 463 470 N/A INTRINSIC
KRBA1 485 527 6.03e-14 SMART
KRBA1 587 630 7.71e-12 SMART
coiled coil region 825 858 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154536
Predicted Effect possibly damaging
Transcript: ENSMUST00000203371
AA Change: T432A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145256
Gene: ENSMUSG00000042810
AA Change: T432A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 97 140 8.1e-8 SMART
KRBA1 193 235 2.5e-18 SMART
KRBA1 254 299 6.4e-16 SMART
KRBA1 367 409 5.7e-12 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 4.6e-18 SMART
KRBA1 586 629 5.8e-16 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204554
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Krba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Krba1 APN 6 48406318 missense possibly damaging 0.95
IGL01663:Krba1 APN 6 48411754 missense probably damaging 0.99
IGL01764:Krba1 APN 6 48415836 missense probably benign 0.01
IGL02036:Krba1 APN 6 48415642 missense possibly damaging 0.95
IGL02333:Krba1 APN 6 48413087 missense probably damaging 0.99
IGL02681:Krba1 APN 6 48404118 missense probably damaging 1.00
IGL03069:Krba1 APN 6 48414549 missense possibly damaging 0.53
IGL03380:Krba1 APN 6 48403453 missense possibly damaging 0.53
PIT4151001:Krba1 UTSW 6 48402897 missense probably damaging 0.99
R0077:Krba1 UTSW 6 48405225 splice site probably benign
R0504:Krba1 UTSW 6 48416254 missense probably benign 0.07
R1051:Krba1 UTSW 6 48413398 missense possibly damaging 0.82
R1875:Krba1 UTSW 6 48414049 splice site probably null
R1912:Krba1 UTSW 6 48415765 missense probably benign 0.45
R2084:Krba1 UTSW 6 48414568 missense probably damaging 1.00
R4035:Krba1 UTSW 6 48411680 missense probably damaging 1.00
R4291:Krba1 UTSW 6 48415665 missense possibly damaging 0.93
R4619:Krba1 UTSW 6 48406348 nonsense probably null
R4638:Krba1 UTSW 6 48409751 nonsense probably null
R4913:Krba1 UTSW 6 48406957 missense probably benign 0.00
R5174:Krba1 UTSW 6 48412295 missense probably damaging 1.00
R5487:Krba1 UTSW 6 48404039 missense probably damaging 1.00
R5496:Krba1 UTSW 6 48406356 missense possibly damaging 0.54
R5514:Krba1 UTSW 6 48413495 missense probably damaging 1.00
R5879:Krba1 UTSW 6 48415744 missense possibly damaging 0.89
R6351:Krba1 UTSW 6 48414128 missense probably benign 0.35
R6516:Krba1 UTSW 6 48413272 nonsense probably null
R7003:Krba1 UTSW 6 48413080 missense possibly damaging 0.71
R7135:Krba1 UTSW 6 48416299 missense probably benign 0.01
R7202:Krba1 UTSW 6 48412327 missense probably damaging 1.00
R7308:Krba1 UTSW 6 48406339 missense probably benign 0.04
R7936:Krba1 UTSW 6 48411669 missense probably damaging 1.00
R8750:Krba1 UTSW 6 48405278 missense probably damaging 0.97
Z1177:Krba1 UTSW 6 48413256 missense probably damaging 1.00
Z1177:Krba1 UTSW 6 48415894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTCCCTGCTCTGAGGAC -3'
(R):5'- TACAACCTCAGCTGGACCAG -3'

Sequencing Primer
(F):5'- AGGACTTCTCCTTATTCCCAAGAG -3'
(R):5'- AGCTCACCTTTCCCAAGCCG -3'
Posted On2015-09-24