Incidental Mutation 'R4568:Rasl2-9'
ID341942
Institutional Source Beutler Lab
Gene Symbol Rasl2-9
Ensembl Gene ENSMUSG00000083649
Gene NameRAS-like, family 2, locus 9
SynonymsRasl2-9-ps, Ran/M2
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R4568 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location5124938-5125950 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGG to A at 5125375 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147835]
Predicted Effect probably null
Transcript: ENSMUST00000147835
SMART Domains Protein: ENSMUSP00000129559
Gene: ENSMUSG00000083649

DomainStartEndE-ValueType
RAN 16 216 1.25e-161 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207732
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Rasl2-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Rasl2-9 APN 7 5125347 missense probably benign 0.00
R1500:Rasl2-9 UTSW 7 5125442 nonsense probably null
R4566:Rasl2-9 UTSW 7 5125375 frame shift probably null
R4567:Rasl2-9 UTSW 7 5125375 frame shift probably null
R4745:Rasl2-9 UTSW 7 5125703 missense possibly damaging 0.90
R7301:Rasl2-9 UTSW 7 5125740 missense probably damaging 1.00
R8025:Rasl2-9 UTSW 7 5125482 missense not run
Predicted Primers PCR Primer
(F):5'- TCCTTTAGCTAAATAAGGTGGCAC -3'
(R):5'- TCCCCATTGTATTGTGTGGC -3'

Sequencing Primer
(F):5'- CACACACTGCACCGCTGG -3'
(R):5'- GGCAACAAAGTGGATGTTAAAGAC -3'
Posted On2015-09-24