Mutagenetix > Incidental Mutations

Incidental Mutation 'R4568:Gpr139'

341945

Institutional Source

Beutler Lab

Gene Symbol

Gpr139

Ensembl Gene

ENSMUSG00000066197

Gene Name

G protein-coupled receptor 139

Synonyms

LOC209776, GPRg1

MMRRC Submission

041792-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119140747-119184603 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119144805 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 186 (V186M)

Ref Sequence

ENSEMBL: ENSMUSP00000081700 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084650]

Predicted Effect

probably damaging
Transcript: ENSMUST00000084650
AA Change: V186M

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000081700
Gene: ENSMUSG00000066197
AA Change: V186M

Domain	Start	End	E-Value	Type
Pfam:7tm_1	35	277	2.9e-18	PFAM

Meta Mutation Damage Score

0.1470

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin family of G-protein-coupled receptors. The encoded protein is almost exclusively expressed in the central nervous system. L-tryptophan and L-phenylalanine may act as the physiologic ligands of the encoded protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,563,517	W5R	probably benign	Het
Bik	T	C	15: 83,541,444		probably null	Het
Col6a1	A	T	10: 76,719,197		probably benign	Het
Crem	A	G	18: 3,299,175	I83T	probably damaging	Het
Csn1s1	G	A	5: 87,680,904	V276I	possibly damaging	Het
Ctnna3	C	T	10: 63,852,809	T344M	possibly damaging	Het
Dgcr8	G	A	16: 18,280,394	P378S	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fam208a	A	T	14: 27,476,701		probably null	Het
Krba1	A	G	6: 48,409,723	T422A	probably damaging	Het
Lgals8	T	G	13: 12,453,373	Y125S	probably damaging	Het
Map4k1	G	A	7: 28,986,654	G107D	probably damaging	Het
Mfsd6	A	T	1: 52,663,289	Y599*	probably null	Het
Olfr1411	A	T	1: 92,597,391	M291L	probably benign	Het
Olfr412	A	G	11: 74,365,209	E180G	probably damaging	Het
Omt2b	T	A	9: 78,328,247		probably benign	Het
Pga5	A	G	19: 10,671,852	Y235H	probably damaging	Het
Phldb2	T	A	16: 45,777,718	K869*	probably null	Het
Pik3cb	T	C	9: 99,090,302	M268V	probably benign	Het
Pla2g4a	T	C	1: 149,842,226	D624G	probably benign	Het
Plxna4	T	A	6: 32,152,938	I1817F	probably damaging	Het
Psmg3	A	G	5: 139,826,249	I32T	probably damaging	Het
Ptpn4	T	C	1: 119,680,059	E757G	probably damaging	Het
Rasl2-9	AGG	A	7: 5,125,375		probably null	Het
Ripply3	T	A	16: 94,335,829	D116E	probably damaging	Het
Robo4	T	C	9: 37,404,822	V263A	possibly damaging	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Spef2	T	C	15: 9,647,217	H1008R	probably damaging	Het
Stag1	T	C	9: 100,848,669	V379A	probably damaging	Het
Tbc1d9	A	G	8: 83,271,177	E1121G	probably benign	Het
Tpr	T	C	1: 150,392,959		probably benign	Het
Trpv6	G	T	6: 41,626,569	P206H	probably damaging	Het
Vmn2r63	T	C	7: 42,933,826		probably null	Het
Vmn2r65	C	T	7: 84,947,469	C126Y	probably damaging	Het

Other mutations in Gpr139

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00924:Gpr139	APN	7	119184287	missense	probably benign	0.10
IGL02103:Gpr139	APN	7	119145132	missense	possibly damaging	0.88
IGL02714:Gpr139	APN	7	119145119	missense	possibly damaging	0.90
IGL02893:Gpr139	APN	7	119145143	missense	probably damaging	1.00
R0082:Gpr139	UTSW	7	119145045	missense	probably benign	0.11
R0542:Gpr139	UTSW	7	119145083	missense	probably benign
R1912:Gpr139	UTSW	7	119144879	missense	possibly damaging	0.62
R2148:Gpr139	UTSW	7	119144969	missense	probably benign	0.08
R4633:Gpr139	UTSW	7	119144405	missense	probably damaging	0.99
R5039:Gpr139	UTSW	7	119144942	missense	probably benign	0.45
R5186:Gpr139	UTSW	7	119144840	missense	probably benign	0.00
R5252:Gpr139	UTSW	7	119145204	missense	probably benign	0.13
R6518:Gpr139	UTSW	7	119144511	missense	probably damaging	1.00
R6861:Gpr139	UTSW	7	119144652	missense	probably benign	0.04
R7194:Gpr139	UTSW	7	119144673	missense	possibly damaging	0.66
R7213:Gpr139	UTSW	7	119145099	missense	probably benign
R7311:Gpr139	UTSW	7	119144866	missense	probably benign	0.06
R7390:Gpr139	UTSW	7	119144612	missense	probably benign	0.00
R7705:Gpr139	UTSW	7	119144643	missense	probably benign	0.06
R8101:Gpr139	UTSW	7	119184287	missense	probably benign	0.10
RF008:Gpr139	UTSW	7	119144867	missense	probably benign	0.01
Z1177:Gpr139	UTSW	7	119144513	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CAACATGATGTGGACCAGCC -3'
(R):5'- TGTCTGTCACCCACTCAAATAC -3'

Sequencing Primer
(F):5'- ACCAGCCAAGGGTTCTGGATG -3'
(R):5'- TACCACACAGTTTCCTACCCAG -3'

Posted On

2015-09-24