Incidental Mutation 'R4568:Gpr139'
ID341945
Institutional Source Beutler Lab
Gene Symbol Gpr139
Ensembl Gene ENSMUSG00000066197
Gene NameG protein-coupled receptor 139
SynonymsLOC209776, GPRg1
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119140747-119184603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119144805 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 186 (V186M)
Ref Sequence ENSEMBL: ENSMUSP00000081700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084650]
Predicted Effect probably damaging
Transcript: ENSMUST00000084650
AA Change: V186M

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081700
Gene: ENSMUSG00000066197
AA Change: V186M

DomainStartEndE-ValueType
Pfam:7tm_1 35 277 2.9e-18 PFAM
Meta Mutation Damage Score 0.1470 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin family of G-protein-coupled receptors. The encoded protein is almost exclusively expressed in the central nervous system. L-tryptophan and L-phenylalanine may act as the physiologic ligands of the encoded protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Gpr139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Gpr139 APN 7 119184287 missense probably benign 0.10
IGL02103:Gpr139 APN 7 119145132 missense possibly damaging 0.88
IGL02714:Gpr139 APN 7 119145119 missense possibly damaging 0.90
IGL02893:Gpr139 APN 7 119145143 missense probably damaging 1.00
R0082:Gpr139 UTSW 7 119145045 missense probably benign 0.11
R0542:Gpr139 UTSW 7 119145083 missense probably benign
R1912:Gpr139 UTSW 7 119144879 missense possibly damaging 0.62
R2148:Gpr139 UTSW 7 119144969 missense probably benign 0.08
R4633:Gpr139 UTSW 7 119144405 missense probably damaging 0.99
R5039:Gpr139 UTSW 7 119144942 missense probably benign 0.45
R5186:Gpr139 UTSW 7 119144840 missense probably benign 0.00
R5252:Gpr139 UTSW 7 119145204 missense probably benign 0.13
R6518:Gpr139 UTSW 7 119144511 missense probably damaging 1.00
R6861:Gpr139 UTSW 7 119144652 missense probably benign 0.04
R7194:Gpr139 UTSW 7 119144673 missense possibly damaging 0.66
R7213:Gpr139 UTSW 7 119145099 missense probably benign
R7311:Gpr139 UTSW 7 119144866 missense probably benign 0.06
R7390:Gpr139 UTSW 7 119144612 missense probably benign 0.00
R7705:Gpr139 UTSW 7 119144643 missense probably benign 0.06
RF008:Gpr139 UTSW 7 119144867 missense probably benign 0.01
Z1177:Gpr139 UTSW 7 119144513 missense not run
Predicted Primers PCR Primer
(F):5'- CAACATGATGTGGACCAGCC -3'
(R):5'- TGTCTGTCACCCACTCAAATAC -3'

Sequencing Primer
(F):5'- ACCAGCCAAGGGTTCTGGATG -3'
(R):5'- TACCACACAGTTTCCTACCCAG -3'
Posted On2015-09-24