Mutagenetix > Incidental Mutations

Incidental Mutation 'R4568:Robo4'

341948

Institutional Source

Beutler Lab

Gene Symbol

Robo4

Ensembl Gene

ENSMUSG00000032125

Gene Name

roundabout guidance receptor 4

Synonyms

1200012D01Rik, Magic roundabout

MMRRC Submission

041792-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R4568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37401897-37415115 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37404822 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 263 (V263A)

Ref Sequence

ENSEMBL: ENSMUSP00000110700 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]

Predicted Effect

probably benign
Transcript: ENSMUST00000102895
AA Change: V374A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: V374A

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	720	733	N/A	INTRINSIC
low complexity region	748	762	N/A	INTRINSIC
low complexity region	775	799	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	871	880	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115046
AA Change: V374A

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: V374A

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115048
AA Change: V263A

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: V263A

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
low complexity region	727	740	N/A	INTRINSIC
low complexity region	755	769	N/A	INTRINSIC
low complexity region	782	806	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156972

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214185
AA Change: V374A

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)

Meta Mutation Damage Score

0.1986

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (36/36)

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,563,517	W5R	probably benign	Het
Bik	T	C	15: 83,541,444		probably null	Het
Col6a1	A	T	10: 76,719,197		probably benign	Het
Crem	A	G	18: 3,299,175	I83T	probably damaging	Het
Csn1s1	G	A	5: 87,680,904	V276I	possibly damaging	Het
Ctnna3	C	T	10: 63,852,809	T344M	possibly damaging	Het
Dgcr8	G	A	16: 18,280,394	P378S	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fam208a	A	T	14: 27,476,701		probably null	Het
Gpr139	C	T	7: 119,144,805	V186M	probably damaging	Het
Krba1	A	G	6: 48,409,723	T422A	probably damaging	Het
Lgals8	T	G	13: 12,453,373	Y125S	probably damaging	Het
Map4k1	G	A	7: 28,986,654	G107D	probably damaging	Het
Mfsd6	A	T	1: 52,663,289	Y599*	probably null	Het
Olfr1411	A	T	1: 92,597,391	M291L	probably benign	Het
Olfr412	A	G	11: 74,365,209	E180G	probably damaging	Het
Omt2b	T	A	9: 78,328,247		probably benign	Het
Pga5	A	G	19: 10,671,852	Y235H	probably damaging	Het
Phldb2	T	A	16: 45,777,718	K869*	probably null	Het
Pik3cb	T	C	9: 99,090,302	M268V	probably benign	Het
Pla2g4a	T	C	1: 149,842,226	D624G	probably benign	Het
Plxna4	T	A	6: 32,152,938	I1817F	probably damaging	Het
Psmg3	A	G	5: 139,826,249	I32T	probably damaging	Het
Ptpn4	T	C	1: 119,680,059	E757G	probably damaging	Het
Rasl2-9	AGG	A	7: 5,125,375		probably null	Het
Ripply3	T	A	16: 94,335,829	D116E	probably damaging	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Spef2	T	C	15: 9,647,217	H1008R	probably damaging	Het
Stag1	T	C	9: 100,848,669	V379A	probably damaging	Het
Tbc1d9	A	G	8: 83,271,177	E1121G	probably benign	Het
Tpr	T	C	1: 150,392,959		probably benign	Het
Trpv6	G	T	6: 41,626,569	P206H	probably damaging	Het
Vmn2r63	T	C	7: 42,933,826		probably null	Het
Vmn2r65	C	T	7: 84,947,469	C126Y	probably damaging	Het

Other mutations in Robo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Robo4	APN	9	37411104	missense	probably damaging	1.00
IGL00392:Robo4	APN	9	37408229	missense	probably damaging	1.00
IGL00491:Robo4	APN	9	37405935	missense	possibly damaging	0.52
IGL00792:Robo4	APN	9	37408211	missense	probably damaging	1.00
IGL01062:Robo4	APN	9	37406000	missense	probably benign	0.08
IGL01287:Robo4	APN	9	37413040	missense	possibly damaging	0.96
IGL02289:Robo4	APN	9	37408200	missense	probably damaging	1.00
IGL02486:Robo4	APN	9	37408374	missense	probably damaging	1.00
IGL02851:Robo4	APN	9	37413382	missense	probably damaging	0.96
IGL02898:Robo4	APN	9	37408176	missense	probably damaging	0.99
IGL02965:Robo4	APN	9	37410469	missense	possibly damaging	0.82
IGL03071:Robo4	APN	9	37404284	splice site	probably benign
IGL03102:Robo4	APN	9	37404185	missense	probably damaging	1.00
H8562:Robo4	UTSW	9	37405810	intron	probably benign
PIT4305001:Robo4	UTSW	9	37411391	missense	probably damaging	1.00
R0056:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0068:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0416:Robo4	UTSW	9	37404766	splice site	probably benign
R1005:Robo4	UTSW	9	37408251	missense	probably damaging	1.00
R1174:Robo4	UTSW	9	37413052	missense	probably damaging	1.00
R1183:Robo4	UTSW	9	37408052	missense	probably damaging	1.00
R1254:Robo4	UTSW	9	37410840	critical splice donor site	probably null
R1398:Robo4	UTSW	9	37408076	critical splice donor site	probably null
R1505:Robo4	UTSW	9	37403227	missense	probably damaging	0.98
R1701:Robo4	UTSW	9	37403443	missense	probably benign	0.44
R1834:Robo4	UTSW	9	37413059	missense	probably benign	0.09
R1899:Robo4	UTSW	9	37404070	splice site	probably benign
R2203:Robo4	UTSW	9	37411490	frame shift	probably null
R2204:Robo4	UTSW	9	37411490	frame shift	probably null
R2351:Robo4	UTSW	9	37411660	missense	probably benign	0.01
R2448:Robo4	UTSW	9	37402662	missense	possibly damaging	0.96
R2847:Robo4	UTSW	9	37404476	nonsense	probably null
R2851:Robo4	UTSW	9	37411490	frame shift	probably null
R2852:Robo4	UTSW	9	37411490	frame shift	probably null
R2877:Robo4	UTSW	9	37411490	frame shift	probably null
R3123:Robo4	UTSW	9	37411490	frame shift	probably null
R3124:Robo4	UTSW	9	37411490	frame shift	probably null
R3125:Robo4	UTSW	9	37411490	frame shift	probably null
R3805:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3806:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3892:Robo4	UTSW	9	37411490	frame shift	probably null
R3905:Robo4	UTSW	9	37403505	nonsense	probably null
R3938:Robo4	UTSW	9	37402017	start gained	probably benign
R4261:Robo4	UTSW	9	37405581	missense	probably benign	0.04
R4434:Robo4	UTSW	9	37411490	frame shift	probably null
R4435:Robo4	UTSW	9	37411490	frame shift	probably null
R4561:Robo4	UTSW	9	37411490	frame shift	probably null
R4562:Robo4	UTSW	9	37411490	frame shift	probably null
R4695:Robo4	UTSW	9	37403199	missense	probably damaging	1.00
R4921:Robo4	UTSW	9	37402560	missense	probably benign
R5000:Robo4	UTSW	9	37408368	missense	probably benign	0.02
R5056:Robo4	UTSW	9	37404806	missense	probably benign	0.00
R5125:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5178:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5278:Robo4	UTSW	9	37411490	frame shift	probably null
R5279:Robo4	UTSW	9	37411490	frame shift	probably null
R5285:Robo4	UTSW	9	37411490	frame shift	probably null
R5347:Robo4	UTSW	9	37411490	frame shift	probably null
R5348:Robo4	UTSW	9	37411490	frame shift	probably null
R5361:Robo4	UTSW	9	37413378	missense	probably benign	0.01
R5403:Robo4	UTSW	9	37411490	frame shift	probably null
R5404:Robo4	UTSW	9	37411490	frame shift	probably null
R5488:Robo4	UTSW	9	37411490	frame shift	probably null
R5489:Robo4	UTSW	9	37411490	frame shift	probably null
R5490:Robo4	UTSW	9	37411490	frame shift	probably null
R5494:Robo4	UTSW	9	37411490	frame shift	probably null
R5629:Robo4	UTSW	9	37408362	missense	probably damaging	1.00
R5736:Robo4	UTSW	9	37404797	missense	possibly damaging	0.63
R5796:Robo4	UTSW	9	37411674	missense	probably benign	0.00
R5987:Robo4	UTSW	9	37411400	missense	probably damaging	1.00
R6178:Robo4	UTSW	9	37405630	nonsense	probably null
R6189:Robo4	UTSW	9	37403533	missense	probably benign	0.35
R6365:Robo4	UTSW	9	37410712	missense	probably benign	0.34
R6528:Robo4	UTSW	9	37404368	missense	possibly damaging	0.92
R6887:Robo4	UTSW	9	37402067	missense	possibly damaging	0.82
R7196:Robo4	UTSW	9	37402705	missense	possibly damaging	0.92
R7408:Robo4	UTSW	9	37410981	missense	probably benign	0.09
R7419:Robo4	UTSW	9	37402809	missense	probably benign	0.18
R7486:Robo4	UTSW	9	37405574	missense	probably damaging	0.99
R7707:Robo4	UTSW	9	37413122	missense	probably damaging	1.00
R7839:Robo4	UTSW	9	37410759	missense	probably damaging	1.00
R8079:Robo4	UTSW	9	37402635	missense	possibly damaging	0.82
R8081:Robo4	UTSW	9	37405640	missense	probably damaging	0.99
R8280:Robo4	UTSW	9	37404076	missense	probably benign	0.00
R8526:Robo4	UTSW	9	37403505	nonsense	probably null
R8547:Robo4	UTSW	9	37404378	missense	possibly damaging	0.69
R8735:Robo4	UTSW	9	37408281	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TTCTCCTGTGTAGAGTGAAGC -3'
(R):5'- GACTAAGTAGGCCCTTGCTCAC -3'

Sequencing Primer
(F):5'- CAAACAGCTGTAAGAAGTGACTTTCC -3'
(R):5'- TTGCTCACTGCTCAAGAAAAG -3'

Posted On

2015-09-24