Incidental Mutation 'R4568:Stag1'
ID341951
Institutional Source Beutler Lab
Gene Symbol Stag1
Ensembl Gene ENSMUSG00000037286
Gene Namestromal antigen 1
SynonymsScc3, SA-1
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location100597798-100959375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100848669 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 379 (V379A)
Ref Sequence ENSEMBL: ENSMUSP00000116205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041418] [ENSMUST00000123302] [ENSMUST00000129269] [ENSMUST00000138405] [ENSMUST00000155108]
Predicted Effect probably damaging
Transcript: ENSMUST00000041418
AA Change: V379A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040724
Gene: ENSMUSG00000037286
AA Change: V379A

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 1.5e-50 PFAM
SCOP:d1qbkb_ 279 850 4e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122824
Predicted Effect probably damaging
Transcript: ENSMUST00000123302
AA Change: V379A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117879
Gene: ENSMUSG00000037286
AA Change: V379A

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 2.9e-51 PFAM
low complexity region 303 315 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129269
AA Change: V379A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116205
Gene: ENSMUSG00000037286
AA Change: V379A

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 160 274 3.8e-41 PFAM
SCOP:d1qbkb_ 279 850 3e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138405
SMART Domains Protein: ENSMUSP00000116322
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 1.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143150
Predicted Effect unknown
Transcript: ENSMUST00000146934
AA Change: V25A
SMART Domains Protein: ENSMUSP00000120974
Gene: ENSMUSG00000037286
AA Change: V25A

DomainStartEndE-ValueType
low complexity region 673 692 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149771
Predicted Effect probably benign
Transcript: ENSMUST00000155108
SMART Domains Protein: ENSMUSP00000118952
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Meta Mutation Damage Score 0.4249 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mouse embryos homozygous for a null mutation show developmental delay and die before birth. Heterozygous animals have shorter lifespan and earlier onset of tumourigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Stag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Stag1 APN 9 100776808 missense probably damaging 1.00
IGL01010:Stag1 APN 9 100945933 missense probably benign 0.06
IGL01012:Stag1 APN 9 100855859 missense possibly damaging 0.47
IGL01025:Stag1 APN 9 100951657 missense possibly damaging 0.95
IGL01307:Stag1 APN 9 100951788 intron probably benign
IGL02149:Stag1 APN 9 100887389 missense probably benign 0.09
IGL02608:Stag1 APN 9 100757769 missense probably null 0.99
IGL03008:Stag1 APN 9 100776791 missense probably damaging 1.00
IGL03210:Stag1 APN 9 100845076 missense possibly damaging 0.63
eto_o UTSW 9 100796716 missense probably damaging 1.00
PIT4280001:Stag1 UTSW 9 100942716 missense possibly damaging 0.95
R0070:Stag1 UTSW 9 100956408 missense probably null 1.00
R0070:Stag1 UTSW 9 100956408 missense probably null 1.00
R0349:Stag1 UTSW 9 100776784 missense probably damaging 0.98
R0479:Stag1 UTSW 9 100928091 missense probably benign 0.00
R0531:Stag1 UTSW 9 100954247 makesense probably null
R0962:Stag1 UTSW 9 100796827 missense probably damaging 1.00
R0976:Stag1 UTSW 9 100776824 missense probably damaging 0.98
R0976:Stag1 UTSW 9 100930016 critical splice donor site probably null
R1170:Stag1 UTSW 9 100888453 intron probably benign
R1499:Stag1 UTSW 9 100855832 missense possibly damaging 0.77
R1499:Stag1 UTSW 9 100887373 intron probably benign
R1644:Stag1 UTSW 9 100880900 intron probably benign
R1747:Stag1 UTSW 9 100888300 missense probably benign
R1799:Stag1 UTSW 9 100953462 splice site probably null
R1807:Stag1 UTSW 9 100908666 missense probably benign 0.34
R1978:Stag1 UTSW 9 100888086 missense probably benign 0.03
R2029:Stag1 UTSW 9 100786687 missense probably damaging 1.00
R2161:Stag1 UTSW 9 100889595 missense probably damaging 1.00
R2300:Stag1 UTSW 9 100712500 missense possibly damaging 0.92
R2327:Stag1 UTSW 9 100786613 missense possibly damaging 0.81
R2426:Stag1 UTSW 9 100845116 critical splice donor site probably null
R2448:Stag1 UTSW 9 100888409 missense probably benign 0.42
R2504:Stag1 UTSW 9 100866210 missense probably damaging 0.99
R3713:Stag1 UTSW 9 100889618 missense probably benign 0.01
R3835:Stag1 UTSW 9 100737982 missense probably damaging 0.97
R3862:Stag1 UTSW 9 100944785 missense probably benign 0.02
R4398:Stag1 UTSW 9 100956606 utr 3 prime probably benign
R4651:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4652:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4653:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4675:Stag1 UTSW 9 100848705 missense probably damaging 1.00
R4709:Stag1 UTSW 9 100738039 missense probably damaging 0.99
R4924:Stag1 UTSW 9 100796755 missense possibly damaging 0.67
R5018:Stag1 UTSW 9 100951619 missense probably benign 0.00
R5435:Stag1 UTSW 9 100953550 missense probably benign 0.03
R5460:Stag1 UTSW 9 100956453 splice site probably null
R5805:Stag1 UTSW 9 100796778 missense probably damaging 1.00
R6127:Stag1 UTSW 9 100951697 missense probably benign 0.05
R6313:Stag1 UTSW 9 100757733 missense probably damaging 1.00
R6597:Stag1 UTSW 9 100887420 missense probably benign 0.01
R6807:Stag1 UTSW 9 100944850 missense probably damaging 1.00
R7099:Stag1 UTSW 9 100944826 missense probably benign 0.02
R7167:Stag1 UTSW 9 100945889 missense probably benign 0.05
R7395:Stag1 UTSW 9 100796728 missense probably damaging 0.99
R7504:Stag1 UTSW 9 100888328 missense probably benign 0.09
R7663:Stag1 UTSW 9 100738138 missense probably damaging 0.98
R7769:Stag1 UTSW 9 100944827 missense possibly damaging 0.86
R8245:Stag1 UTSW 9 100929893 missense probably benign 0.01
R8343:Stag1 UTSW 9 100757766 missense possibly damaging 0.95
R8473:Stag1 UTSW 9 100880787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCCACTTAAATAAGATGGTTTC -3'
(R):5'- GACTGCACAAACAAACTTTTATACG -3'

Sequencing Primer
(F):5'- GCTTTAATCCTGGCACTAGGGAAC -3'
(R):5'- CCGAACCTGGGCTTCATTATAAG -3'
Posted On2015-09-24