Incidental Mutation 'R4568:Ctnna3'
ID341952
Institutional Source Beutler Lab
Gene Symbol Ctnna3
Ensembl Gene ENSMUSG00000060843
Gene Namecatenin (cadherin associated protein), alpha 3
SynonymsCatna3, Vr22, alphaT-catenin, 4930429L08Rik
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63430098-65003667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63852809 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 344 (T344M)
Ref Sequence ENSEMBL: ENSMUSP00000101081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075099] [ENSMUST00000105440] [ENSMUST00000105441]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075099
AA Change: T344M

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074606
Gene: ENSMUSG00000060843
AA Change: T344M

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105440
AA Change: T344M

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101080
Gene: ENSMUSG00000060843
AA Change: T344M

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105441
AA Change: T344M

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101081
Gene: ENSMUSG00000060843
AA Change: T344M

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135474
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the vinculin/alpha-catenin family. The encoded protein plays a role in cell-cell adhesion in muscle cells. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia, familial 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased heart weight, increased ventricle size, dilated cardiomyopathy and increased susceptibility to ischemia-induced arrhythmias and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Ctnna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ctnna3 APN 10 63566833 missense probably damaging 1.00
IGL00823:Ctnna3 APN 10 63537543 missense possibly damaging 0.68
IGL00963:Ctnna3 APN 10 64945949 missense probably damaging 1.00
IGL01388:Ctnna3 APN 10 63504107 missense possibly damaging 0.67
IGL01655:Ctnna3 APN 10 64873170 missense probably benign 0.01
IGL01783:Ctnna3 APN 10 63820469 missense possibly damaging 0.91
IGL01909:Ctnna3 APN 10 63504131 missense probably benign 0.11
IGL02160:Ctnna3 APN 10 64250698 missense probably benign
IGL02267:Ctnna3 APN 10 64945998 missense probably benign 0.20
IGL02524:Ctnna3 APN 10 64260826 missense possibly damaging 0.68
IGL02707:Ctnna3 APN 10 63504065 missense probably benign
IGL03165:Ctnna3 APN 10 64945941 missense probably damaging 0.98
Bipolar UTSW 10 64873207 missense probably damaging 0.96
Catatonia UTSW 10 64585995 missense probably benign
hebephrenia UTSW 10 64260935 missense probably benign 0.17
multiple UTSW 10 64250768 missense probably damaging 1.00
PIT4687001:Ctnna3 UTSW 10 64834606 missense probably damaging 1.00
R0345:Ctnna3 UTSW 10 63566840 missense probably benign 0.00
R0387:Ctnna3 UTSW 10 64586130 missense probably benign 0.00
R0523:Ctnna3 UTSW 10 64675909 missense probably damaging 0.97
R0647:Ctnna3 UTSW 10 63820424 missense probably benign 0.00
R0676:Ctnna3 UTSW 10 64409261 missense probably benign 0.20
R1102:Ctnna3 UTSW 10 64585995 missense probably benign
R1521:Ctnna3 UTSW 10 64959842 missense probably benign 0.22
R1700:Ctnna3 UTSW 10 63852772 missense probably damaging 1.00
R1874:Ctnna3 UTSW 10 63504107 missense possibly damaging 0.67
R1995:Ctnna3 UTSW 10 63820364 missense probably damaging 0.98
R2088:Ctnna3 UTSW 10 64873207 missense probably damaging 0.96
R2198:Ctnna3 UTSW 10 65002745 missense probably benign 0.00
R4056:Ctnna3 UTSW 10 65002568 missense probably damaging 1.00
R4208:Ctnna3 UTSW 10 64959778 missense probably benign 0.22
R4440:Ctnna3 UTSW 10 64260935 missense probably benign 0.17
R4594:Ctnna3 UTSW 10 64586079 missense probably benign 0.32
R4835:Ctnna3 UTSW 10 63581944 missense probably benign 0.01
R4849:Ctnna3 UTSW 10 64873315 missense probably damaging 1.00
R5682:Ctnna3 UTSW 10 64873306 missense probably damaging 0.96
R5777:Ctnna3 UTSW 10 64675885 missense probably benign
R6414:Ctnna3 UTSW 10 64260865 missense probably benign 0.35
R7210:Ctnna3 UTSW 10 64250768 missense probably damaging 1.00
R7220:Ctnna3 UTSW 10 64834589 missense probably benign 0.04
R7680:Ctnna3 UTSW 10 64487550 missense probably benign
R7934:Ctnna3 UTSW 10 64585968 missense probably damaging 1.00
R8006:Ctnna3 UTSW 10 63582011 missense probably benign 0.02
R8272:Ctnna3 UTSW 10 65002598 missense probably damaging 1.00
R8415:Ctnna3 UTSW 10 63504130 missense probably benign 0.05
Z1088:Ctnna3 UTSW 10 63581978 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CCCAGAACTTAATTGTCCTGAACC -3'
(R):5'- GTTCTGACTTCAACCCTCCAAAG -3'

Sequencing Primer
(F):5'- GAACTTAATTGTCCTGAACCCACTC -3'
(R):5'- AGTCCTAAAATCATGCTTCATCCTG -3'
Posted On2015-09-24