Mutagenetix > Incidental Mutations

Incidental Mutation 'R4568:Olfr412'

341954

Institutional Source

Beutler Lab

Gene Symbol

Olfr412

Ensembl Gene

ENSMUSG00000058275

Gene Name

olfactory receptor 412

Synonyms

MOR127-5P, GA_x6K02T2P1NL-4500587-4501525

MMRRC Submission

041792-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R4568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74362069-74366218 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74365209 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 180 (E180G)

Ref Sequence

ENSEMBL: ENSMUSP00000149922 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077794] [ENSMUST00000216362]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077794
AA Change: E180G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076967
Gene: ENSMUSG00000058275
AA Change: E180G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	1.7e-51	PFAM
Pfam:7TM_GPCR_Srsx	35	172	1.8e-8	PFAM
Pfam:7tm_1	41	289	3.8e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000216362
AA Change: E180G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Meta Mutation Damage Score

0.2271

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,563,517	W5R	probably benign	Het
Bik	T	C	15: 83,541,444		probably null	Het
Col6a1	A	T	10: 76,719,197		probably benign	Het
Crem	A	G	18: 3,299,175	I83T	probably damaging	Het
Csn1s1	G	A	5: 87,680,904	V276I	possibly damaging	Het
Ctnna3	C	T	10: 63,852,809	T344M	possibly damaging	Het
Dgcr8	G	A	16: 18,280,394	P378S	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fam208a	A	T	14: 27,476,701		probably null	Het
Gpr139	C	T	7: 119,144,805	V186M	probably damaging	Het
Krba1	A	G	6: 48,409,723	T422A	probably damaging	Het
Lgals8	T	G	13: 12,453,373	Y125S	probably damaging	Het
Map4k1	G	A	7: 28,986,654	G107D	probably damaging	Het
Mfsd6	A	T	1: 52,663,289	Y599*	probably null	Het
Olfr1411	A	T	1: 92,597,391	M291L	probably benign	Het
Omt2b	T	A	9: 78,328,247		probably benign	Het
Pga5	A	G	19: 10,671,852	Y235H	probably damaging	Het
Phldb2	T	A	16: 45,777,718	K869*	probably null	Het
Pik3cb	T	C	9: 99,090,302	M268V	probably benign	Het
Pla2g4a	T	C	1: 149,842,226	D624G	probably benign	Het
Plxna4	T	A	6: 32,152,938	I1817F	probably damaging	Het
Psmg3	A	G	5: 139,826,249	I32T	probably damaging	Het
Ptpn4	T	C	1: 119,680,059	E757G	probably damaging	Het
Rasl2-9	AGG	A	7: 5,125,375		probably null	Het
Ripply3	T	A	16: 94,335,829	D116E	probably damaging	Het
Robo4	T	C	9: 37,404,822	V263A	possibly damaging	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Spef2	T	C	15: 9,647,217	H1008R	probably damaging	Het
Stag1	T	C	9: 100,848,669	V379A	probably damaging	Het
Tbc1d9	A	G	8: 83,271,177	E1121G	probably benign	Het
Tpr	T	C	1: 150,392,959		probably benign	Het
Trpv6	G	T	6: 41,626,569	P206H	probably damaging	Het
Vmn2r63	T	C	7: 42,933,826		probably null	Het
Vmn2r65	C	T	7: 84,947,469	C126Y	probably damaging	Het

Other mutations in Olfr412

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Olfr412	APN	11	74364912	missense	possibly damaging	0.82
IGL01395:Olfr412	APN	11	74364887	missense	probably damaging	1.00
IGL01418:Olfr412	APN	11	74364984	missense	possibly damaging	0.85
IGL01645:Olfr412	APN	11	74365533	missense	possibly damaging	0.95
IGL02421:Olfr412	APN	11	74365191	missense	probably damaging	1.00
IGL02424:Olfr412	APN	11	74365473	missense	probably benign	0.09
R0206:Olfr412	UTSW	11	74365142	missense	probably benign	0.00
R0206:Olfr412	UTSW	11	74365142	missense	probably benign	0.00
R0278:Olfr412	UTSW	11	74365202	missense	probably damaging	1.00
R0698:Olfr412	UTSW	11	74365142	missense	probably benign	0.00
R1424:Olfr412	UTSW	11	74364954	missense	probably benign	0.05
R1549:Olfr412	UTSW	11	74365250	missense	probably benign	0.00
R1659:Olfr412	UTSW	11	74364933	missense	probably benign	0.01
R1755:Olfr412	UTSW	11	74364993	missense	probably damaging	1.00
R2031:Olfr412	UTSW	11	74364951	missense	probably damaging	1.00
R2185:Olfr412	UTSW	11	74364746	missense	probably benign
R3620:Olfr412	UTSW	11	74365224	missense	probably damaging	1.00
R4878:Olfr412	UTSW	11	74364848	missense	probably damaging	1.00
R7779:Olfr412	UTSW	11	74364945	missense	probably damaging	1.00
R8086:Olfr412	UTSW	11	74364954	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TATGTGGCCATCTGTCACCC -3'
(R):5'- ACACAGTGTCCCATAGAAGAGG -3'

Sequencing Primer
(F):5'- CCCTCCATTACACTACAGCCATGAG -3'
(R):5'- TGTCCCATAGAAGAGGGCCAC -3'

Posted On

2015-09-24