Incidental Mutation 'R4568:Olfr412'
ID341954
Institutional Source Beutler Lab
Gene Symbol Olfr412
Ensembl Gene ENSMUSG00000058275
Gene Nameolfactory receptor 412
SynonymsMOR127-5P, GA_x6K02T2P1NL-4500587-4501525
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74362069-74366218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74365209 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 180 (E180G)
Ref Sequence ENSEMBL: ENSMUSP00000149922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077794] [ENSMUST00000216362]
Predicted Effect probably damaging
Transcript: ENSMUST00000077794
AA Change: E180G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076967
Gene: ENSMUSG00000058275
AA Change: E180G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 172 1.8e-8 PFAM
Pfam:7tm_1 41 289 3.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216362
AA Change: E180G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.2271 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Olfr412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Olfr412 APN 11 74364912 missense possibly damaging 0.82
IGL01395:Olfr412 APN 11 74364887 missense probably damaging 1.00
IGL01418:Olfr412 APN 11 74364984 missense possibly damaging 0.85
IGL01645:Olfr412 APN 11 74365533 missense possibly damaging 0.95
IGL02421:Olfr412 APN 11 74365191 missense probably damaging 1.00
IGL02424:Olfr412 APN 11 74365473 missense probably benign 0.09
R0206:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R0206:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R0278:Olfr412 UTSW 11 74365202 missense probably damaging 1.00
R0698:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R1424:Olfr412 UTSW 11 74364954 missense probably benign 0.05
R1549:Olfr412 UTSW 11 74365250 missense probably benign 0.00
R1659:Olfr412 UTSW 11 74364933 missense probably benign 0.01
R1755:Olfr412 UTSW 11 74364993 missense probably damaging 1.00
R2031:Olfr412 UTSW 11 74364951 missense probably damaging 1.00
R2185:Olfr412 UTSW 11 74364746 missense probably benign
R3620:Olfr412 UTSW 11 74365224 missense probably damaging 1.00
R4878:Olfr412 UTSW 11 74364848 missense probably damaging 1.00
R7779:Olfr412 UTSW 11 74364945 missense probably damaging 1.00
R8086:Olfr412 UTSW 11 74364954 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TATGTGGCCATCTGTCACCC -3'
(R):5'- ACACAGTGTCCCATAGAAGAGG -3'

Sequencing Primer
(F):5'- CCCTCCATTACACTACAGCCATGAG -3'
(R):5'- TGTCCCATAGAAGAGGGCCAC -3'
Posted On2015-09-24