Incidental Mutation 'R4568:Lgals8'
ID341955
Institutional Source Beutler Lab
Gene Symbol Lgals8
Ensembl Gene ENSMUSG00000057554
Gene Namelectin, galactose binding, soluble 8
SynonymsLgals-8, 1200015E08Rik, D13Ertd524e
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location12439415-12464944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 12453373 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 125 (Y125S)
Ref Sequence ENSEMBL: ENSMUSP00000114200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099820] [ENSMUST00000099821] [ENSMUST00000124888] [ENSMUST00000135166] [ENSMUST00000143693] [ENSMUST00000144283]
Predicted Effect probably damaging
Transcript: ENSMUST00000099820
AA Change: Y125S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097408
Gene: ENSMUSG00000057554
AA Change: Y125S

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099821
AA Change: Y125S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097409
Gene: ENSMUSG00000057554
AA Change: Y125S

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124888
AA Change: Y125S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115094
Gene: ENSMUSG00000057554
AA Change: Y125S

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135060
Predicted Effect probably damaging
Transcript: ENSMUST00000135166
AA Change: Y32S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120210
Gene: ENSMUSG00000057554
AA Change: Y32S

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143693
AA Change: Y32S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118925
Gene: ENSMUSG00000057554
AA Change: Y32S

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144283
AA Change: Y125S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114200
Gene: ENSMUSG00000057554
AA Change: Y125S

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 193 325 1.38e-48 SMART
Gal-bind_lectin 199 324 1.28e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155871
Meta Mutation Damage Score 0.9618 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galectin family. Galectins are beta-galactoside-binding animal lectins with conserved carbohydrate recognition domains. The galectins have been implicated in many essential functions including development, differentiation, cell-cell adhesion, cell-matrix interaction, growth regulation, apoptosis, and RNA splicing. This gene is widely expressed in tumoral tissues and seems to be involved in integrin-like cell interactions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced VEGF-C-induced lymphangiogenesis, and ameliorated corneal pathology and lymphangiogenesis in a model of herpes simplex virus keratitis. Mice homozygous for a gene trapped allele exhibit hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Lgals8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01601:Lgals8 APN 13 12456338 splice site probably benign
IGL02407:Lgals8 APN 13 12454818 missense probably benign 0.01
R0015:Lgals8 UTSW 13 12447298 missense probably damaging 1.00
R0015:Lgals8 UTSW 13 12447298 missense probably damaging 1.00
R0973:Lgals8 UTSW 13 12451395 splice site probably benign
R1452:Lgals8 UTSW 13 12453327 nonsense probably null
R1748:Lgals8 UTSW 13 12454943 missense probably damaging 1.00
R1939:Lgals8 UTSW 13 12459188 missense probably benign 0.00
R2076:Lgals8 UTSW 13 12454869 nonsense probably null
R2214:Lgals8 UTSW 13 12454832 missense probably benign 0.02
R4791:Lgals8 UTSW 13 12453322 missense possibly damaging 0.94
R5243:Lgals8 UTSW 13 12454764 missense probably benign 0.27
R6947:Lgals8 UTSW 13 12454801 start gained probably benign
R7476:Lgals8 UTSW 13 12448481 missense probably damaging 0.97
R7515:Lgals8 UTSW 13 12448462 nonsense probably null
R7942:Lgals8 UTSW 13 12453256 critical splice donor site probably null
R8208:Lgals8 UTSW 13 12453374 missense probably damaging 1.00
R8674:Lgals8 UTSW 13 12447236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATTTGAGGTCCCACAAAC -3'
(R):5'- TGTGGTGCTGGAGATGAAAC -3'

Sequencing Primer
(F):5'- TTTGAGGTCCCACAAACAACAAAAG -3'
(R):5'- AGATGAAACCCGGGGCTTCAC -3'
Posted On2015-09-24