Incidental Mutation 'R4568:Dgcr8'
ID341957
Institutional Source Beutler Lab
Gene Symbol Dgcr8
Ensembl Gene ENSMUSG00000022718
Gene NameDGCR8, microprocessor complex subunit
SynonymsGy1, D16H22S788E, D16Wis2, D16H22S1742E, Vo59c07, N41
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18253948-18289246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18280394 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 378 (P378S)
Ref Sequence ENSEMBL: ENSMUSP00000009321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000115633] [ENSMUST00000232424]
Predicted Effect probably benign
Transcript: ENSMUST00000009321
AA Change: P378S

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718
AA Change: P378S

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115633
SMART Domains Protein: ENSMUSP00000111296
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232414
Predicted Effect probably benign
Transcript: ENSMUST00000232424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232476
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the microprocessor complex which mediates the biogenesis of microRNAs from the primary microRNA transcript. The encoded protein is a double-stranded RNA binding protein that functions as the non-catalytic subunit of the microprocessor complex. This protein is required for binding the double-stranded RNA substrate and facilitates cleavage of the RNA by the ribonuclease III protein, Drosha. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice heterozygous for a gene trap allele exhibit reduced dendritic spine number and dendritiic complexity along with abnormal prepulse inhibition and abnormal spatial working memory. Homozygous mice are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Dgcr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Dgcr8 APN 16 18283944 missense probably damaging 1.00
IGL01767:Dgcr8 APN 16 18278336 missense probably damaging 0.98
IGL02349:Dgcr8 APN 16 18280306 missense possibly damaging 0.67
IGL02834:Dgcr8 APN 16 18272759 missense probably benign 0.08
disneyland UTSW 16 18259623 missense probably damaging 1.00
R1558:Dgcr8 UTSW 16 18259588 missense probably damaging 1.00
R1587:Dgcr8 UTSW 16 18280291 missense probably damaging 1.00
R1656:Dgcr8 UTSW 16 18256713 missense probably benign 0.00
R1866:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R1886:Dgcr8 UTSW 16 18278354 missense possibly damaging 0.95
R2144:Dgcr8 UTSW 16 18284256 missense probably damaging 1.00
R2145:Dgcr8 UTSW 16 18280230 missense probably benign 0.26
R3773:Dgcr8 UTSW 16 18256775 missense probably damaging 0.99
R4783:Dgcr8 UTSW 16 18258310 nonsense probably null
R4784:Dgcr8 UTSW 16 18258310 nonsense probably null
R5138:Dgcr8 UTSW 16 18278077 missense probably damaging 0.99
R5276:Dgcr8 UTSW 16 18283771 missense probably benign 0.01
R5476:Dgcr8 UTSW 16 18259979 missense probably damaging 1.00
R5510:Dgcr8 UTSW 16 18277175 missense probably damaging 0.98
R5745:Dgcr8 UTSW 16 18280443 missense probably benign 0.01
R5771:Dgcr8 UTSW 16 18272768 missense probably benign 0.25
R6035:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R6035:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R6182:Dgcr8 UTSW 16 18280308 missense probably benign 0.00
R6190:Dgcr8 UTSW 16 18284410 missense probably damaging 0.97
R6633:Dgcr8 UTSW 16 18284182 missense possibly damaging 0.94
R6786:Dgcr8 UTSW 16 18283829 nonsense probably null
R7468:Dgcr8 UTSW 16 18259623 missense probably damaging 1.00
Z1176:Dgcr8 UTSW 16 18278318 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCAACTGATTCATCTTTGCACAC -3'
(R):5'- ATACGGGTAGGGGAGTCATC -3'

Sequencing Primer
(F):5'- TGCACACCTCAACTTTAGCC -3'
(R):5'- AGTCATCTGCCATGTATTTAGGC -3'
Posted On2015-09-24