Incidental Mutation 'R4568:Ripply3'
ID341960
Institutional Source Beutler Lab
Gene Symbol Ripply3
Ensembl Gene ENSMUSG00000022941
Gene Nameripply transcriptional repressor 3
SynonymsDscr6
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location94328420-94336935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94335829 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 116 (D116E)
Ref Sequence ENSEMBL: ENSMUSP00000023660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023660]
Predicted Effect probably damaging
Transcript: ENSMUST00000023660
AA Change: D116E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023660
Gene: ENSMUSG00000022941
AA Change: D116E

DomainStartEndE-ValueType
Pfam:Ripply 39 127 6.2e-35 PFAM
Meta Mutation Damage Score 0.1495 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Homozygotes for a reporter allele show complete neonatal lethality, abnormal development of the pharyngeal apparatus and its derivatives including ectopic formation of the thymus and the parathyroid gland, and cardiovascular defects such as deletion of the aortic arch and misshapen great vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Ripply3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Ripply3 APN 16 94328543 missense possibly damaging 0.89
R0271:Ripply3 UTSW 16 94335757 missense possibly damaging 0.82
R7400:Ripply3 UTSW 16 94335900 missense probably benign 0.32
R8021:Ripply3 UTSW 16 94328510 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACAAGGAACAGGGGCTTTTG -3'
(R):5'- GGCTCCCTTCATTTGCTAGAG -3'

Sequencing Primer
(F):5'- TTGGTGGAAGCTTGCCCC -3'
(R):5'- TCATTTGCTAGAGCTCTCGC -3'
Posted On2015-09-24